Rmu_sc0004594.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004594.1
Physical Location & Seq
Forward (+)
1494 .. 2237
744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004594.1_g000001.1.cds

Sequence Viewer

Length: 471 bp
atggcggcaaccaccaccgccaagacttcggctttaactcccaaactcaagagcttcgccccagtcctcctgctcctcctcatccttgtcttatcaaccatctccaacggatctgcgaatcggatcaagttggttaagaatcagatccacatctgctgcaacatgtcgtcggaagggcagtgctctcagaaccctaagtgtcggtggtgtcgcagtgagtccctggacgacatgtgcttccccaagtccgaggctttggaagagaacgacaacttggcagctgcggcggcggcgtactcagggctgatgagggcgtcgtcgcttccaacgcagacggaggaggagtcgaggaagaggaaggagttgcaaacgctgcggcggttggaggcgaagcagaggaggtcagagaagcagaggaacagcagcagcagcagtaaggaggaagagctggcattaactagttcttcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

156

Amino Acids

17.18

Weight (kDa)

9.13

Isoelectric Point (pI)

75.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 7 cut(s) 5, 18, 284, 287, 290, 376, 379
AclWI GGATC 3 cut(s) 118, 131, 139
AcyI GRCGYC 1 cut(s) 314
AfaI GTAC 1 cut(s) 296
AflIII ACRYGT 2 cut(s) 162, 231
AhlI ACTAGT 1 cut(s) 458
AjnI CCWGG 1 cut(s) 222
AjuI GAANNNNNNNTTGG 2 cut(s) 257, 289
AluBI AGCT 3 cut(s) 54, 281, 448
AluI AGCT 3 cut(s) 54, 281, 448
Alw21I GWGCWC 1 cut(s) 185
AlwI GGATC 3 cut(s) 118, 131, 139
ApeKI GCWGC 7 cut(s) 156, 278, 281, 373, 423, 426, 429
Bbv12I GWGCWC 1 cut(s) 185
BbvI GCAGC 7 cut(s) 143, 268, 290, 360, 435, 438, 441
BccI CCATC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 224
BcuI ACTAGT 1 cut(s) 458
BfaI CTAG 1 cut(s) 459
Bme1390I CCNGG 1 cut(s) 224
BmrFI CCNGG 1 cut(s) 224
BmrI ACTGGG 1 cut(s) 56
BmuI ACTGGG 1 cut(s) 56
BpuEI CTTGAG 1 cut(s) 32
BsaBI GATNNNNATC 1 cut(s) 149
BsaHI GRCGYC 1 cut(s) 314
BsaJI CCNNGG 2 cut(s) 222, 249
BsaXI ACNNNNNCTCC 2 cut(s) 329, 359
Bse1I ACTGG 1 cut(s) 62
Bse8I GATNNNNATC 1 cut(s) 149
BseBI CCWGG 1 cut(s) 224
BseDI CCNNGG 2 cut(s) 222, 249
BseGI GGATG 1 cut(s) 81
BseJI GATNNNNATC 1 cut(s) 149
BseMII CTCAG 2 cut(s) 200, 312
BseNI ACTGG 1 cut(s) 62
BseRI GAGGAG 5 cut(s) 65, 68, 353, 356, 412
BseXI GCAGC 7 cut(s) 143, 268, 290, 360, 435, 438, 441
BsiHKAI GWGCWC 1 cut(s) 185
BslFI GGGAC 1 cut(s) 205
BsmFI GGGAC 1 cut(s) 205
Bsp1286I GDGCHC 1 cut(s) 185
Bsp143I GATC 3 cut(s) 110, 123, 144
BspACI CCGC 7 cut(s) 5, 18, 284, 287, 290, 376, 379
BspCNI CTCAG 2 cut(s) 199, 311
BspHI TCATGA 1 cut(s) 467
BspPI GGATC 3 cut(s) 118, 131, 139
BspQI GCTCTTC 1 cut(s) 438
BsrI ACTGG 1 cut(s) 62
BssECI CCNNGG 2 cut(s) 222, 249
BssMI GATC 3 cut(s) 110, 123, 144
BssNI GRCGYC 1 cut(s) 314
Bst2UI CCWGG 1 cut(s) 224
Bst6I CTCTTC 3 cut(s) 255, 347, 438
BstACI GRCGYC 1 cut(s) 314
BstAPI GCANNNNNTGC 1 cut(s) 373
BstC8I GCNNGC 1 cut(s) 450
BstDEI CTNAG 3 cut(s) 186, 195, 298
BstF5I GGATG 1 cut(s) 81
BstKTI GATC 3 cut(s) 113, 126, 147
BstMBI GATC 3 cut(s) 110, 123, 144
BstMWI GCNNNNNNNGC 6 cut(s) 284, 287, 290, 328, 373, 429
BstNI CCWGG 1 cut(s) 224
BstNSI RCATGY 2 cut(s) 166, 235
BstSCI CCNGG 1 cut(s) 222
BstV1I GCAGC 7 cut(s) 143, 268, 290, 360, 435, 438, 441
BstX2I RGATCY 2 cut(s) 110, 144
BstYI RGATCY 2 cut(s) 110, 144
BtsCI GGATG 1 cut(s) 81
BtsI GCAGTG 2 cut(s) 185, 220
BtsIMutI CAGTG 2 cut(s) 185, 220
Cac8I GCNNGC 1 cut(s) 450
CciI TCATGA 1 cut(s) 467
CseI GACGC 1 cut(s) 303
Csp6I GTAC 1 cut(s) 295
CviAII CATG 3 cut(s) 163, 232, 468
CviJI RGCY 6 cut(s) 32, 54, 254, 281, 304, 448
CviKI_1 RGCY 6 cut(s) 32, 54, 254, 281, 304, 448
CviQI GTAC 1 cut(s) 295
DdeI CTNAG 3 cut(s) 186, 195, 298
DpnI GATC 3 cut(s) 112, 125, 146
DpnII GATC 3 cut(s) 110, 123, 144
Eam1104I CTCTTC 3 cut(s) 255, 347, 438
EarI CTCTTC 3 cut(s) 255, 347, 438
EcoRII CCWGG 1 cut(s) 222
FaeI CATG 3 cut(s) 166, 235, 471
FaiI YATR 3 cut(s) 164, 233, 469
FaqI GGGAC 1 cut(s) 205
FatI CATG 3 cut(s) 162, 231, 467
FokI GGATG 1 cut(s) 68
FspBI CTAG 1 cut(s) 459
HgaI GACGC 1 cut(s) 303
Hin1I GRCGYC 1 cut(s) 314
Hin1II CATG 3 cut(s) 166, 235, 471
HinfI GANTC 4 cut(s) 118, 139, 218, 344
Hpy188I TCNGA 6 cut(s) 123, 144, 172, 189, 250, 406
Hpy188III TCNNGA 2 cut(s) 49, 468
Hpy99I CGWCG 3 cut(s) 172, 319, 322
HpyAV CCTTC 2 cut(s) 167, 352
HpyCH4V TGCA 2 cut(s) 159, 367
HpyF10VI GCNNNNNNNGC 6 cut(s) 284, 287, 290, 328, 373, 429
HpyF3I CTNAG 3 cut(s) 186, 195, 298
Hsp92I GRCGYC 1 cut(s) 314
Hsp92II CATG 3 cut(s) 166, 235, 471
Kzo9I GATC 3 cut(s) 110, 123, 144
LguI GCTCTTC 1 cut(s) 438
LmnI GCTCC 1 cut(s) 78
LpnPI CCDG 6 cut(s) 75, 83, 209, 236, 285, 434
Lsp1109I GCAGC 7 cut(s) 143, 268, 290, 360, 435, 438, 441
MaeI CTAG 1 cut(s) 459
MalI GATC 3 cut(s) 112, 125, 146
MboI GATC 3 cut(s) 110, 123, 144
MboII GAAGA 4 cut(s) 272, 364, 455, 456
MflI RGATCY 2 cut(s) 110, 144
MhlI GDGCHC 1 cut(s) 185
MlyI GAGTC 2 cut(s) 227, 353
MmeI TCCRAC 4 cut(s) 129, 150, 350, 363
MseI TTAA 3 cut(s) 35, 135, 455
MspA1I CMGCKG 1 cut(s) 281
MspR9I CCNGG 1 cut(s) 224
MvaI CCWGG 1 cut(s) 224
MwoI GCNNNNNNNGC 6 cut(s) 284, 287, 290, 328, 373, 429
NdeII GATC 3 cut(s) 110, 123, 144
NlaIII CATG 3 cut(s) 166, 235, 471
NspI RCATGY 2 cut(s) 166, 235
PagI TCATGA 1 cut(s) 467
PciI ACATGT 2 cut(s) 162, 231
PciSI GCTCTTC 1 cut(s) 438
PfeI GAWTC 2 cut(s) 118, 139
PleI GAGTC 2 cut(s) 226, 352
PpsI GAGTC 2 cut(s) 226, 352
PscI ACATGT 2 cut(s) 162, 231
Psp6I CCWGG 1 cut(s) 222
PspGI CCWGG 1 cut(s) 222
PsuI RGATCY 2 cut(s) 110, 144
PvuII CAGCTG 1 cut(s) 281
RsaI GTAC 1 cut(s) 296
RsaNI GTAC 1 cut(s) 295
SapI GCTCTTC 1 cut(s) 438
SaqAI TTAA 3 cut(s) 35, 135, 455
Sau3AI GATC 3 cut(s) 110, 123, 144
SchI GAGTC 2 cut(s) 227, 353
ScrFI CCNGG 1 cut(s) 224
SduI GDGCHC 1 cut(s) 185
SetI ASST 4 cut(s) 56, 283, 404, 450
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
SpeI ACTAGT 1 cut(s) 458
SsiI CCGC 7 cut(s) 5, 18, 284, 287, 290, 376, 379
SspMI CTAG 1 cut(s) 459
StyD4I CCNGG 1 cut(s) 222
TaqI TCGA 1 cut(s) 347
TauI GCSGC 5 cut(s) 8, 287, 290, 293, 379
TfiI GAWTC 2 cut(s) 118, 139
Tru1I TTAA 3 cut(s) 35, 135, 455
Tru9I TTAA 3 cut(s) 35, 135, 455
TscAI CASTG 2 cut(s) 185, 220
TseI GCWGC 7 cut(s) 156, 278, 281, 373, 423, 426, 429
TspDTI ATGAA 1 cut(s) 456
TspGWI ACGGA 2 cut(s) 123, 350
TspRI CASTG 2 cut(s) 185, 220
XceI RCATGY 2 cut(s) 166, 235
XspI CTAG 1 cut(s) 459
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.