Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004898.1

Orthogroup ID

OG0008227

Physical Location & Seq

Genomic Coordinates Forward (+)

13074 .. 13709

Gene Structure 636 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004898.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 555 bp

atgggagagaaggaatggcactttttctgtgtgagggatagaaagtatccaactggtctgaggacaaacagagcaactgaagctggatattggaaagctactgggaaagacaaggagatttacaaagggaaatccttggttggcatgaagaagacccttgttttctacaggggcagagccccaataggtgaaaagaacaaatgggtgatttgtagggtctttgaaaaatctgctggtggtaaaaaaatccatatcactggacttgtgaatttgggttctcatggaactgaaatgcgttcttctggtttaccaccattgttggacacagcgccttacaatggtgccaagaccagaccggcttcagagtcgaattacgtgccctgcttctccaaccatgaatccattgattctcaaagaaaccaagggattgttgattacatcaaaggcaatcctcttttctccgtttcttcgaatccttcaaacaacaacgctttcccacgagtcacgtatcagaattcactctattctgctcctgtttcatcaggaaatttctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NAM

Protein Analysis

184

Amino Acids

20.47

Weight (kDa)

9.78

Isoelectric Point (pI)

24.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008227)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G07680 AT5G07680 AT5G61430 AT5G61430
fragaria_vesca	FvH4_5g14670 FvH4_5g14670
malus_domestica	MD06G1196100.v1.1 MD14G1203000.v1.1
prunus_persica	Prupe.5G196000_v2.0.a1
pyrus_communis	pycom06g17320 pycom14g16800
rosa_chinensis	RchiOBHm_Chr7g0181751 RchiOBHm_Chr7g0181811
rosa_laevigata	RLG00000005172
rosa_multiflora	Rmu_sc0000988.1_g000005 Rmu_sc0004898.1_g000004
rosa_roxburghii	Rroxscaffold_3G00271760
rosa_rugosa	Rorug06G0443200
rosa_samantha	Rh7AG045700 Rh7BG045000 Rh7CG046400 Rh7DG045300
rosa_wichuraiana	Rw7G003810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	341
AcsI	RAATTY	3 cut(s)	268, 514, 547
AcuI	CTGAAG	2 cut(s)	99, 345
AfiI	CCNNNNNNNGG	1 cut(s)	338
AgsI	TTSAA	2 cut(s)	224, 480
AluBI	AGCT	2 cut(s)	83, 98
AluI	AGCT	2 cut(s)	83, 98
ApoI	RAATTY	3 cut(s)	268, 514, 547
AspLEI	GCGC	1 cut(s)	331
AsuHPI	GGTGA	2 cut(s)	200, 217
AsuII	TTCGAA	1 cut(s)	470
BaeGI	GKGCMC	1 cut(s)	381
BanI	GGYRCC	1 cut(s)	341
BanII	GRGCYC	1 cut(s)	181
BauI	CACGAG	1 cut(s)	498
BbsI	GAAGAC	1 cut(s)	158
BcgI	CGANNNNNNTGC	2 cut(s)	358, 392
BciVI	GTATCC	1 cut(s)	57
BfaI	CTAG	1 cut(s)	553
BfmI	CTRYAG	1 cut(s)	166
BfoI	RGCGCY	1 cut(s)	332
BfuI	GTATCC	1 cut(s)	57
BmiI	GGNNCC	1 cut(s)	343
BmrI	ACTGGG	1 cut(s)	111
BmuI	ACTGGG	1 cut(s)	111
BpiI	GAAGAC	1 cut(s)	158
Bpu14I	TTCGAA	1 cut(s)	470
BsaAI	YACGTR	2 cut(s)	376, 507
BsaJI	CCNNGG	2 cut(s)	135, 421
Bsc4I	CCNNNNNNNGG	1 cut(s)	338
Bse118I	RCCGGY	1 cut(s)	355
Bse1I	ACTGG	3 cut(s)	58, 106, 262
BseDI	CCNNGG	2 cut(s)	135, 421
BseLI	CCNNNNNNNGG	1 cut(s)	338
BseMII	CTCAG	1 cut(s)	50
BseNI	ACTGG	3 cut(s)	58, 106, 262
BseSI	GKGCMC	1 cut(s)	381
BshNI	GGYRCC	1 cut(s)	341
BsiSI	CCGG	1 cut(s)	356
BslI	CCNNNNNNNGG	1 cut(s)	338
Bsp119I	TTCGAA	1 cut(s)	470
Bsp1286I	GDGCHC	2 cut(s)	181, 381
BspCNI	CTCAG	1 cut(s)	51
BspLI	GGNNCC	1 cut(s)	343
BspT104I	TTCGAA	1 cut(s)	470
BspT107I	GGYRCC	1 cut(s)	341
BsrFI	RCCGGY	1 cut(s)	355
BsrI	ACTGG	3 cut(s)	58, 106, 262
BssAI	RCCGGY	1 cut(s)	355
BssECI	CCNNGG	2 cut(s)	135, 421
BssSI	CACGAG	1 cut(s)	498
BssT1I	CCWWGG	2 cut(s)	135, 421
Bst2BI	CACGAG	1 cut(s)	498
BstBAI	YACGTR	2 cut(s)	376, 507
BstBI	TTCGAA	1 cut(s)	470
BstDEI	CTNAG	1 cut(s)	59
BstH2I	RGCGCY	1 cut(s)	332
BstHHI	GCGC	1 cut(s)	331
BstMWI	GCNNNNNNNGC	1 cut(s)	80
BstSFI	CTRYAG	1 cut(s)	166
BstSLI	GKGCMC	1 cut(s)	381
BstV2I	GAAGAC	1 cut(s)	158
BstXI	CCANNNNNNTGG	1 cut(s)	257
BsuI	GTATCC	1 cut(s)	57
BtsIMutI	CAGTG	1 cut(s)	255
CfoI	GCGC	1 cut(s)	331
Cfr10I	RCCGGY	1 cut(s)	355
CspCI	CAANNNNNGTGG	2 cut(s)	300, 335
CviAII	CATG	3 cut(s)	145, 281, 395
CviJI	RGCY	4 cut(s)	83, 98, 179, 359
CviKI_1	RGCY	4 cut(s)	83, 98, 179, 359
DdeI	CTNAG	1 cut(s)	59
Eco130I	CCWWGG	2 cut(s)	135, 421
Eco24I	GRGCYC	1 cut(s)	181
Eco57I	CTGAAG	2 cut(s)	99, 345
EcoRI	GAATTC	1 cut(s)	514
EcoT14I	CCWWGG	2 cut(s)	135, 421
EcoT38I	GRGCYC	1 cut(s)	181
ErhI	CCWWGG	2 cut(s)	135, 421
FaeI	CATG	3 cut(s)	148, 284, 398
FaiI	YATR	4 cut(s)	146, 252, 282, 396
FatI	CATG	3 cut(s)	144, 280, 394
FriOI	GRGCYC	1 cut(s)	181
FspBI	CTAG	1 cut(s)	553
GlaI	GCGC	1 cut(s)	330
HaeII	RGCGCY	1 cut(s)	332
HapII	CCGG	1 cut(s)	356
HhaI	GCGC	1 cut(s)	331
Hin1II	CATG	3 cut(s)	148, 284, 398
Hin6I	GCGC	1 cut(s)	329
HinP1I	GCGC	1 cut(s)	329
HinfI	GANTC	5 cut(s)	365, 398, 407, 472, 501
HpaII	CCGG	1 cut(s)	356
HphI	GGTGA	2 cut(s)	200, 217
Hpy166II	GTNNAC	1 cut(s)	308
Hpy188I	TCNGA	3 cut(s)	60, 364, 513
Hpy188III	TCNNGA	1 cut(s)	543
Hpy8I	GTNNAC	1 cut(s)	308
HpyAV	CCTTC	2 cut(s)	4, 486
HpyCH4IV	ACGT	2 cut(s)	375, 506
HpyF10VI	GCNNNNNNNGC	1 cut(s)	80
HpyF3I	CTNAG	1 cut(s)	59
HpySE526I	ACGT	2 cut(s)	375, 506
Hsp92II	CATG	3 cut(s)	148, 284, 398
HspAI	GCGC	1 cut(s)	329
LmnI	GCTCC	1 cut(s)	535
MaeI	CTAG	1 cut(s)	553
MaeII	ACGT	2 cut(s)	375, 506
MaeIII	GTNAC	1 cut(s)	502
MboII	GAAGA	4 cut(s)	160, 163, 291, 459
MhlI	GDGCHC	2 cut(s)	181, 381
MluCI	AATT	4 cut(s)	268, 370, 514, 547
MlyI	GAGTC	2 cut(s)	374, 510
MmeI	TCCRAC	3 cut(s)	74, 300, 414
MnlI	CCTC	3 cut(s)	27, 54, 462
MspI	CCGG	1 cut(s)	356
MwoI	GCNNNNNNNGC	1 cut(s)	80
NlaIII	CATG	3 cut(s)	148, 284, 398
NlaIV	GGNNCC	1 cut(s)	343
NmuCI	GTSAC	1 cut(s)	502
NspV	TTCGAA	1 cut(s)	470
PfeI	GAWTC	3 cut(s)	398, 407, 472
PleI	GAGTC	2 cut(s)	373, 509
PpsI	GAGTC	2 cut(s)	373, 509
Ppu21I	YACGTR	2 cut(s)	376, 507
PspN4I	GGNNCC	1 cut(s)	343
SchI	GAGTC	2 cut(s)	374, 510
SduI	GDGCHC	2 cut(s)	181, 381
SetI	ASST	5 cut(s)	85, 100, 190, 378, 509
SfcI	CTRYAG	1 cut(s)	166
SfuI	TTCGAA	1 cut(s)	470
Sse9I	AATT	4 cut(s)	268, 370, 514, 547
SspMI	CTAG	1 cut(s)	553
StyI	CCWWGG	2 cut(s)	135, 421
TaiI	ACGT	2 cut(s)	378, 509
TaqI	TCGA	2 cut(s)	368, 470
TasI	AATT	4 cut(s)	268, 370, 514, 547
TfiI	GAWTC	3 cut(s)	398, 407, 472
TscAI	CASTG	1 cut(s)	262
TseFI	GTSAC	1 cut(s)	502
Tsp45I	GTSAC	1 cut(s)	502
TspDTI	ATGAA	3 cut(s)	161, 411, 528
TspGWI	ACGGA	1 cut(s)	451
TspRI	CASTG	1 cut(s)	262
XapI	RAATTY	3 cut(s)	268, 514, 547
XspI	CTAG	1 cut(s)	553

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.