Rmu_sc0005008.1_g000001

N-terminal C2 in EEIG1 and EHBP1 proteins

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005008.1
Physical Location & Seq
Forward (+)
732 .. 9060
8329 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005008.1_g000001.1.cds

Sequence Viewer

Length: 5940 bp
atgtcgaggatcactaagtggaagcttgagaagacaaaagtgaaggtggttttcaggctacaattcaacgctacacatattccccaaagcggatgggataagttgtttatatctttcatacctgctgattctggaaaggcaactgcaaagacaaccaaagcaaatgtgaggaatggaacatgcaaatgggcagatcctatctacgaaactacaagacttctacaagacactaaaacaaagaaatttgatgagaagctctataaacttgtggtgaccatgggctcttcacggtctagtgtccttggggagaccaatatcaaccttgctgattatgccgacgcatcaaagccttctgctgttgcactgcctctacatggatgtgattctggaactattttacatgtaactgtacagctattaacttccaaaactggtttcagagagtttgaacagcagagggagctcagagagagtggtttatgtacaacgtcagaccaaagcagaaatgatgtgtccactgctaaaagaatatcgtcttccgaagatacaatcaatgcgagagttaggttcaaagaagaactctctccccttgaagacgaggttgggcggaatgaagagtttccagactcaactgtagggtttgatggttcttccaatacttcagaaagtttatacactgagaaacatgatacctccagcacccatgagattgacagccttaagagtacaacctctggtgatttgggtggactgtcccttggtcaaagtcctcgaaaggagaaaggagaccactctgatcaacgtttcttggtacaggggaccagtgagtgggctcatagttgggcttctgactattctggagatgccgacttgccaaatgcttatgaggagaatagtagacttagaggaagcttggaagcagctgagtcatccattcttgagcttaagcaggaagtaagctctttacagagccaagctgatgaaataggagttgaagcccaaaaattttcccttcaacttgatgcagaaatttgttcaagtgaacagttagccaaagaagtttctatactgagatcagaatgttcaaaattgaaagaagatcttgaagtgcagaaaaactccaaattaagaattccattcaccagcacagaaactattgagacaggtcaggaggactttttgcaggagttacagctcaggtggctaaaggggcttggggatgtggaggataaaattaaagagcttcaaagcaaagcaaccgttggagtacatgagagggacttcaggtcctttcattcagatttagaggcattgcttggtgttttgcaagttctaaagccagtaactggacaaccgattttggggatgaacaaggcaagcgtaaaggagacaaatgaaacgagtgtacataaagatgagcaattagtactaggaactaggtttgatgcagatttctatcctgaaggtatgcttcatagtctaagtatgcctggcttggtgtcacaagagtttgattctttagatgctacaaatgcaatgaaaagcaaattctttgagcttttaagagagttggatgaattaaaagctgagcgagagagccttgccaaaaaagcagaccagatggagtgctactatgaagctctcattcatgaattagaagaaaatcagagacagatgatgggggagttgcagagtctcagaaatgagcattctacttgcctgtacacaatttcatctgctaaagctgagatggggagaatccagctagatatgaacaatgagataacaaaattttccaaagaaaggcatgatttggaatctctcaccaaggagctcgaaagaagggctgctacagcagaagcagcacttaaaagggcacgcttgaattactccattgcggtggaccatttacagaaggaccttgaattgctttcttctcaggtcctgtccatgcatgagactaatgagaacctcattaagcaagcttttgcagattctgtgcttccaagctttcaggggcgtgaggtgatgatgcagaatccgaaatgggaatcagagatttttcattctggaaagcacatgcagcgtccaaaccaaagcaatggtgtaaaaagacaacatttagacggggatatactatcagacgatctgagaagatctctcctcttgcagaaggaaacataccaaaaggttgaagaagaagtttatgaagtgcatctggtgaatgtatatttggacatcttctcaaagaccctagaggtcactttgattgaagcaagtgctgactttggattggtcaaagagaaagtgcatgaacttacacaccagctggagctttcaactgaatcaaaggagttattgatgctgaggctacagactgccttggatgagattcgctgcctgaatgaagacaagtacatttggaattcaaagtgcaatgacttgactctaaagaaccaaaatttggaagaagattttcggactgccatggatgagattcgctgcctgaatgagtacaaggatacttgcaattcaaagtgcaatgacttgactctgaagaaccacagtttggaagaagatttgcagaaagttactagagaaaataatcttcattctcagaagattgctgaatggaaagatcttgtaaaagaatatgaaacctatgagagcaaatatagagcctgcagtacagaaaaattggagttagcaaatttattggaaaaggaagccctagagaataagaatcttcaaaacagactttcatctttgcaggaagagttgaaagctgtcagaaatgactgtgatgaggtgacatatggaaaggagagtctacagaatattgtaaattcttcacagggtaagttgtggaatctgttggcatcatatgatataaagtataaaggtctgtctctgtctctctgcagtgaatataactctcaaaatttgggatccaaggatttaactgctgtggtggtgcaaatagaagagcttcagcacaatttatatgagaagattgtccagcttatggaagagaagaaagacctagcacaagaaagagatactttaagagcagccaattctgataatctgatcatgaaacagaaatttgaacaagatctacggggtatgatggataaactagatgtttcaaatgccctggtgcaaaagcttcagttacaagttggggccattgctaacaaacttcagattagttctgagattgaagagagatatgcacaacagcacaaagaactgttggctgatctggatcagttggaaatggagctgcagcaaatttcttttaaataccaggaccttgcggaggaaattatggcattggagactgtaaccgatgaactaggaaggtgtaaactgacgatagcagcattatcggaggaaaaagaagctctagtggtgtccttgcaggataaaactgaagaatctttcaagctttctctggaggttaatagtttgcaaggaagtttgctgtcttcacgtgatgagttgcacattgagaaaaatcacagagataagttagccagtacaatttcagatctcacttcccaattggaccagaagcatagtcagtctctagattttgatcagcagaaggatgagctggtccacctcaaacagttgttatcagaatcagagctagagaaatcaagagtttgtggtctcctgttggataccgagaaatgtctaaaggatgctcgtgaagaatgttcttctatatctgctctgcaagcccatttgtctgaaatgtatgaattttcaatagctgctgatgttggactcactttcacaaaggctcaatacgagaccaagattgaagagcttgatcagaaacttcacttttctgatagctgcctatctgagctttgcgacaatcatcttcatgtagaaaatatgcttaacagatgtcttgcaagcgaaaagcatttagttgaagagaacaccaaactaatgacaagattaaatgatgctggtgaagaatgtgcttttgtatctgctctggaagctcagttgtctgaaatgcatgaagtttcaatagctgccgatgttggactcaccttcgtagaagctcagtatggggccaagattgaagagctttgccacaaacttcactcttctgatagtcacctttctgagctttgcaacaatcaccttcatgtggagaataagcttaatgaatgtcttgctagtgaaaggtattacattgaagagaacaccaaattaatggcaagtctcagctcccttaactctgagttagaagcctccatttctcaaaacaagatacttcttgatacaaacagttccatgaggacagaactcaaggaatacaagaaaagagctgaaaatgcagcagctattgatcatgtggataaaagtcagtttgctcctgagattgaaaggctggagcatattgtggtgacttctaatgaagagattgataacctgatattctccaaggaagaactagaaatcaaatatttagtgctcaaggccaagttggatgaacagtggactcaaatagcctctctggaagcatataaagataaattgacagtgatgcataataatgaatgcaatgatcttaaacagaggcttgctgaacaggttttgaaggcagatgaatttaagaacttgtccatccatttcaaggagcttaaagacaagtcttgtgttgagtgtctccatgcacctgacaaaagagaaccagaagcgccgccagctcctatgcaagagtccttaagaatcgcattcatcaaagaacaatatgaaaccaagctgcaagaactgaaacagcaacttgccatctccaagaagcattgtgaggagatgctgtggaaattacaagatgcaatcaatgaagttgataacaggaagaaatctgaagctactcatgtaaaaagaaacgaagagctaggaatgaggatcttggaattggagtctgagctacaatcattgctttctgaaaagcgtgaaataatgagagcatatgatctgatgaaggctgaaaaggaatgttcattaataagcctcgactgctgtaaagaagaaaaacaagatcttgaagcatctttgcagaagtgcaacgaggaaaaagttcaaattactttagaactctcttcagcaaaagatttgcttgagagctcttcatcttctaatcagagagaggggaacggaagattacacaaagaagatggcatttctgatgaagcagctggactggaatacttgaattccattgatgaacccgagaaggatgatattgtatccagaggtataaatggaatttctagtgttttaccttcgaaacaaatggacgtgcttaatagtgacgtgaagcatttggttcttgccaatgagcattacagggcccaaagcttaaggtctagcatggagaacttaaataaggagttggaaaggatgaaacatgaaaatttgcttccccaagatgatcatcattttgactcaaattttcctggtttacaaagagacctgatgcaattaaataaggttaatgaagaattgggaagtatttttcccttgttcaacgagtattcttgcagtggcaatgcattagagagagtactagctttagaaattgaacttgcagaagcattgcaggcaaagaagaaatcatccttccagtttcaaagttctttcttgaaacaacatgatgacgaggaagcagtgtttcacagctttagagacataaatgagctgattaaagacatgctggagatcaagggaagatatgctactgtggagacagaacttaaagaaatgcatgaccgttacagtcaattaagccttcaatttgcagaggttgaaggagagaggcagaaactaatgatgactctcaagaatgttcgagcatcaaagaagcatagtttaaaccgctcctcgacaaccactctactggatccctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1979

Amino Acids

225.74

Weight (kDa)

5.04

Isoelectric Point (pI)

49.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 130
AccB7I CCANNNNNTGG 5 cut(s) 828, 1346, 2464, 2569, 3025
AccBSI CCGCTC 1 cut(s) 5910
AccI GTMKAC 2 cut(s) 898, 2830
AciI CCGC 6 cut(s) 90, 607, 1898, 3320, 4730, 5908
AclI AACGTT 1 cut(s) 802
AclWI GGATC 7 cut(s) 17, 188, 2943, 2956, 3276, 4946, 5927
AcvI CACGTG 1 cut(s) 3497
AdeI CACNNNGTG 1 cut(s) 18
AflII CTTAAG 4 cut(s) 719, 944, 4753, 5392
AflIII ACRYGT 1 cut(s) 400
AhdI GACNNNNNGTC 1 cut(s) 1285
AjiI CACGTC 2 cut(s) 5332, 5347
AjnI CCWGG 4 cut(s) 1489, 3156, 3309, 5488
Alw21I GWGCWC 4 cut(s) 465, 1836, 4503, 5159
AlwI GGATC 7 cut(s) 17, 188, 2943, 2956, 3276, 4946, 5927
AlwNI CAGNNNCTG 3 cut(s) 1346, 1945, 1997
Ama87I CYCGRG 1 cut(s) 5261
AoxI GGCC 4 cut(s) 3186, 4095, 4506, 5382
ApaI GGGCCC 1 cut(s) 5386
AseI ATTAAT 2 cut(s) 4238, 5036
Asp700I GAANNNNTTC 4 cut(s) 618, 2475, 2988, 5109
AspLEI GCGC 1 cut(s) 4729
AsuII TTCGAA 1 cut(s) 5318
AvaI CYCGRG 1 cut(s) 5261
AvaII GGWCC 8 cut(s) 819, 1287, 1903, 1918, 1942, 3313, 3571, 3622
BaeGI GKGCMC 2 cut(s) 1879, 5386
BamHI GGATCC 2 cut(s) 2948, 5932
BanII GRGCYC 6 cut(s) 284, 465, 835, 1836, 5159, 5386
BarI GAAGNNNNNNTAC 8 cut(s) 1050, 1082, 1834, 1866, 2165, 2197, 5752, 5784
BauI CACGAG 1 cut(s) 3714
BbrPI CACGTG 1 cut(s) 3497
BbsI GAAGAC 5 cut(s) 38, 528, 600, 2415, 3483
Bbv12I GWGCWC 4 cut(s) 465, 1836, 4503, 5159
BbvCI CCTCAGC 1 cut(s) 2366
BccI CCATC 9 cut(s) 87, 638, 1615, 1672, 1744, 3124, 4661, 4826, 5201
BcgI CGANNNNNNTGC 2 cut(s) 3372, 3406
BciT130I CCWGG 4 cut(s) 1491, 3158, 3311, 5490
BciVI GTATCC 3 cut(s) 2515, 3682, 5290
BclI TGATCA 6 cut(s) 796, 3090, 3601, 3841, 4375, 5464
BfmI CTRYAG 7 cut(s) 633, 1851, 2372, 2683, 2831, 2920, 3287
BfoI RGCGCY 1 cut(s) 4730
BfrI CTTAAG 4 cut(s) 719, 944, 4753, 5392
BfuAI ACCTGC 1 cut(s) 130
BfuI GTATCC 3 cut(s) 2515, 3682, 5290
BglII AGATCT 6 cut(s) 1099, 2156, 2638, 3115, 3553, 5071
BlpI GCTNAGC 1 cut(s) 1587
BmcAI AGTACT 2 cut(s) 1428, 5598
Bme1390I CCNGG 4 cut(s) 1491, 3158, 3311, 5490
Bme18I GGWCC 8 cut(s) 819, 1287, 1903, 1918, 1942, 3313, 3571, 3622
BmeRI GACNNNNNGTC 1 cut(s) 1285
BmeT110I CYCGRG 1 cut(s) 5261
BmgBI CACGTC 2 cut(s) 5332, 5347
BmiI GGNNCC 6 cut(s) 820, 2950, 3187, 4096, 5384, 5934
BmrFI CCNGG 4 cut(s) 1491, 3158, 3311, 5490
BpiI GAAGAC 5 cut(s) 38, 528, 600, 2415, 3483
BplI GAGNNNNNCTC 2 cut(s) 2143, 2175
BpmI CTGGAG 6 cut(s) 679, 879, 2351, 3479, 4439, 5768
Bpu10I CCTNAGC 2 cut(s) 1196, 2366
Bpu1102I GCTNAGC 1 cut(s) 1587
Bpu14I TTCGAA 1 cut(s) 5318
BpuEI CTTGAG 6 cut(s) 47, 959, 4319, 4487, 5171, 5855
BsaAI YACGTR 1 cut(s) 3497
BsaBI GATNNNNATC 4 cut(s) 1455, 3267, 3600, 5466
BsaI GGTCTC 5 cut(s) 302, 780, 3683, 3815, 5496
BsaJI CCNNGG 9 cut(s) 276, 301, 757, 1827, 2382, 2487, 2952, 3156, 4470
BsaXI ACNNNNNCTCC 2 cut(s) 4832, 4862
Bse1I ACTGG 8 cut(s) 436, 822, 1340, 1351, 3540, 5238, 5656, 5934
Bse8I GATNNNNATC 4 cut(s) 1455, 3267, 3600, 5466
BseBI CCWGG 4 cut(s) 1491, 3158, 3311, 5490
BseDI CCNNGG 9 cut(s) 276, 301, 757, 1827, 2382, 2487, 2952, 3156, 4470
BseJI GATNNNNATC 4 cut(s) 1455, 3267, 3600, 5466
BseNI ACTGG 8 cut(s) 436, 822, 1340, 1351, 3540, 5238, 5656, 5934
BseRI GAGGAG 4 cut(s) 902, 2153, 4853, 5902
BseSI GKGCMC 2 cut(s) 1879, 5386
BsgI GTGCAG 1 cut(s) 1130
BshFI GGCC 4 cut(s) 3188, 4097, 4508, 5384
BsiHKAI GWGCWC 4 cut(s) 465, 1836, 4503, 5159
BsiHKCI CYCGRG 1 cut(s) 5261
BslFI GGGAC 3 cut(s) 739, 832, 1292
BsmFI GGGAC 3 cut(s) 739, 832, 1292
BsmI GAATGC 3 cut(s) 1708, 4592, 4763
BsnI GGCC 4 cut(s) 3188, 4097, 4508, 5384
Bso31I GGTCTC 5 cut(s) 302, 780, 3683, 3815, 5496
BsoBI CYCGRG 1 cut(s) 5261
Bsp119I TTCGAA 1 cut(s) 5318
Bsp120I GGGCCC 1 cut(s) 5382
Bsp1286I GDGCHC 8 cut(s) 284, 465, 835, 1836, 1879, 4503, 5159, 5386
Bsp1407I TGTACA 4 cut(s) 409, 482, 1405, 1722
Bsp1720I GCTNAGC 1 cut(s) 1587
Bsp19I CCATGG 2 cut(s) 276, 2487
BspACI CCGC 6 cut(s) 90, 607, 1898, 3320, 4730, 5908
BspANI GGCC 4 cut(s) 3188, 4097, 4508, 5384
BspHI TCATGA 2 cut(s) 1648, 3093
BspLI GGNNCC 6 cut(s) 820, 2950, 3187, 4096, 5384, 5934
BspMAI CTGCAG 3 cut(s) 2687, 2924, 3291
BspMI ACCTGC 1 cut(s) 130
BspPI GGATC 7 cut(s) 17, 188, 2943, 2956, 3276, 4946, 5927
BspQI GCTCTTC 6 cut(s) 289, 2979, 3828, 4101, 4917, 5164
BspT104I TTCGAA 1 cut(s) 5318
BspTI CTTAAG 4 cut(s) 719, 944, 4753, 5392
BspTNI GGTCTC 5 cut(s) 302, 780, 3683, 3815, 5496
BsrBI CCGCTC 1 cut(s) 5910
BsrGI TGTACA 4 cut(s) 409, 482, 1405, 1722
BsrI ACTGG 8 cut(s) 436, 822, 1340, 1351, 3540, 5238, 5656, 5934
BssECI CCNNGG 9 cut(s) 276, 301, 757, 1827, 2382, 2487, 2952, 3156, 4470
BssSI CACGAG 1 cut(s) 3714
BssT1I CCWWGG 8 cut(s) 276, 301, 757, 1827, 2382, 2487, 2952, 4470
Bst2BI CACGAG 1 cut(s) 3714
Bst2UI CCWGG 4 cut(s) 1491, 3158, 3311, 5490
BstAFI CTTAAG 4 cut(s) 719, 944, 4753, 5392
BstAUI TGTACA 4 cut(s) 409, 482, 1405, 1722
BstBAI YACGTR 1 cut(s) 3497
BstBI TTCGAA 1 cut(s) 5318
BstC8I GCNNGC 9 cut(s) 1378, 1879, 1983, 2683, 3747, 3931, 4611, 4734, 5634
BstDSI CCRYGG 2 cut(s) 276, 2487
BstEII GGTNACC 1 cut(s) 271
BstENI CCTNNNNNAGG 1 cut(s) 3320
BstH2I RGCGCY 1 cut(s) 4730
BstHHI GCGC 1 cut(s) 4729
BstNI CCWGG 4 cut(s) 1491, 3158, 3311, 5490
BstNSI RCATGY 4 cut(s) 183, 404, 2083, 5746
BstPI GGTNACC 1 cut(s) 271
BstSCI CCNGG 4 cut(s) 1489, 3156, 3309, 5488
BstSFI CTRYAG 7 cut(s) 633, 1851, 2372, 2683, 2831, 2920, 3287
BstSLI GKGCMC 2 cut(s) 1879, 5386
BstV2I GAAGAC 5 cut(s) 38, 528, 600, 2415, 3483
BstXI CCANNNNNNTGG 4 cut(s) 1900, 2102, 4240, 5929
BsuI GTATCC 3 cut(s) 2515, 3682, 5290
BsuRI GGCC 4 cut(s) 3188, 4097, 4508, 5384
BtgI CCRYGG 2 cut(s) 276, 2487
BtrI CACGTC 2 cut(s) 5332, 5347
BtsI GCAGTG 5 cut(s) 362, 516, 2929, 5581, 5706
BtsIMutI CAGTG 9 cut(s) 362, 516, 675, 829, 2929, 4529, 4575, 5581, 5706
BveI ACCTGC 1 cut(s) 130
Cac8I GCNNGC 9 cut(s) 1378, 1879, 1983, 2683, 3747, 3931, 4611, 4734, 5634
CaiI CAGNNNCTG 3 cut(s) 1346, 1945, 1997
CciI TCATGA 2 cut(s) 1648, 3093
CfoI GCGC 1 cut(s) 4729
CseI GACGC 2 cut(s) 347, 2075
DraI TTTAAA 2 cut(s) 3304, 5904
DraIII CACNNNGTG 1 cut(s) 18
DriI GACNNNNNGTC 1 cut(s) 1285
Eam1105I GACNNNNNGTC 1 cut(s) 1285
EciI GGCGGA 1 cut(s) 622
Ecl136II GAGCTC 3 cut(s) 463, 1834, 5157
Eco130I CCWWGG 8 cut(s) 276, 301, 757, 1827, 2382, 2487, 2952, 4470
Eco24I GRGCYC 6 cut(s) 284, 465, 835, 1836, 5159, 5386
Eco31I GGTCTC 5 cut(s) 302, 780, 3683, 3815, 5496
Eco47I GGWCC 8 cut(s) 819, 1287, 1903, 1918, 1942, 3313, 3571, 3622
Eco53kI GAGCTC 3 cut(s) 463, 1834, 5157
Eco72I CACGTG 1 cut(s) 3497
Eco88I CYCGRG 1 cut(s) 5261
Eco91I GGTNACC 1 cut(s) 271
EcoICRI GAGCTC 3 cut(s) 463, 1834, 5157
EcoNI CCTNNNNNAGG 1 cut(s) 3320
EcoO109I RGGNCCY 5 cut(s) 1287, 1918, 1942, 3313, 5382
EcoO65I GGTNACC 1 cut(s) 271
EcoRI GAATTC 3 cut(s) 1131, 2425, 5245
EcoRII CCWGG 4 cut(s) 1489, 3156, 3309, 5488
EcoT14I CCWWGG 8 cut(s) 276, 301, 757, 1827, 2382, 2487, 2952, 4470
EcoT22I ATGCAT 5 cut(s) 1956, 4041, 4578, 5587, 5799
EcoT38I GRGCYC 6 cut(s) 284, 465, 835, 1836, 5159, 5386
ErhI CCWWGG 8 cut(s) 276, 301, 757, 1827, 2382, 2487, 2952, 4470
FaqI GGGAC 3 cut(s) 739, 832, 1292
FauNDI CATATG 3 cut(s) 2815, 2884, 5002
FbaI TGATCA 6 cut(s) 796, 3090, 3601, 3841, 4375, 5464
FblI GTMKAC 2 cut(s) 898, 2830
FriOI GRGCYC 6 cut(s) 284, 465, 835, 1836, 5159, 5386
GlaI GCGC 1 cut(s) 4728
GsuI CTGGAG 6 cut(s) 679, 879, 2351, 3479, 4439, 5768
HaeII RGCGCY 1 cut(s) 4730
HaeIII GGCC 4 cut(s) 3188, 4097, 4508, 5384
HgaI GACGC 2 cut(s) 347, 2075
HhaI GCGC 1 cut(s) 4729
Hin6I GCGC 1 cut(s) 4727
HinP1I GCGC 1 cut(s) 4727
HindIII AAGCTT 8 cut(s) 23, 910, 1983, 2008, 3167, 3449, 4184, 5389
Hpy99I CGWCG 1 cut(s) 341
HpyCH4IV ACGT 5 cut(s) 488, 802, 3496, 5331, 5346
HpySE526I ACGT 5 cut(s) 488, 802, 3496, 5331, 5346
HspAI GCGC 1 cut(s) 4727
Ksp22I TGATCA 6 cut(s) 796, 3090, 3601, 3841, 4375, 5464
LguI GCTCTTC 6 cut(s) 289, 2979, 3828, 4101, 4917, 5164
MaeII ACGT 5 cut(s) 488, 802, 3496, 5331, 5346
MbiI CCGCTC 1 cut(s) 5910
MfeI CAATTG 1 cut(s) 3566
MhlI GDGCHC 8 cut(s) 284, 465, 835, 1836, 1879, 4503, 5159, 5386
MmeI TCCRAC 8 cut(s) 1243, 1551, 3255, 3666, 3772, 4045, 4494, 5406
Mph1103I ATGCAT 5 cut(s) 1956, 4041, 4578, 5587, 5799
MroXI GAANNNNTTC 4 cut(s) 618, 2475, 2988, 5109
MslI CAYNNNNRTG 7 cut(s) 184, 378, 1413, 1898, 3897, 4170, 4581
MspA1I CMGCKG 3 cut(s) 923, 2329, 5228
MspCI CTTAAG 4 cut(s) 719, 944, 4753, 5392
MspR9I CCNGG 4 cut(s) 1491, 3158, 3311, 5490
MssI GTTTAAAC 1 cut(s) 5904
MunI CAATTG 1 cut(s) 3566
Mva1269I GAATGC 3 cut(s) 1708, 4592, 4763
MvaI CCWGG 4 cut(s) 1491, 3158, 3311, 5490
NcoI CCATGG 2 cut(s) 276, 2487
NdeI CATATG 3 cut(s) 2815, 2884, 5002
NlaIV GGNNCC 6 cut(s) 820, 2950, 3187, 4096, 5384, 5934
NmuCI GTSAC 7 cut(s) 271, 1500, 2260, 2809, 4139, 4432, 5342
NsiI ATGCAT 5 cut(s) 1956, 4041, 4578, 5587, 5799
NspI RCATGY 4 cut(s) 183, 404, 2083, 5746
NspV TTCGAA 1 cut(s) 5318
PagI TCATGA 2 cut(s) 1648, 3093
PciI ACATGT 1 cut(s) 400
PciSI GCTCTTC 6 cut(s) 289, 2979, 3828, 4101, 4917, 5164
PctI GAATGC 3 cut(s) 1708, 4592, 4763
PdmI GAANNNNTTC 4 cut(s) 618, 2475, 2988, 5109
PflMI CCANNNNNTGG 5 cut(s) 828, 1346, 2464, 2569, 3025
PmaCI CACGTG 1 cut(s) 3497
PmeI GTTTAAAC 1 cut(s) 5904
PmlI CACGTG 1 cut(s) 3497
Ppu21I YACGTR 1 cut(s) 3497
PpuMI RGGWCCY 4 cut(s) 1287, 1918, 1942, 3313
PscI ACATGT 1 cut(s) 400
PshBI ATTAAT 2 cut(s) 4238, 5036
Psp124BI GAGCTC 3 cut(s) 465, 1836, 5159
Psp1406I AACGTT 1 cut(s) 802
Psp5II RGGWCCY 4 cut(s) 1287, 1918, 1942, 3313
Psp6I CCWGG 4 cut(s) 1489, 3156, 3309, 5488
PspCI CACGTG 1 cut(s) 3497
PspEI GGTNACC 1 cut(s) 271
PspGI CCWGG 4 cut(s) 1489, 3156, 3309, 5488
PspN4I GGNNCC 6 cut(s) 820, 2950, 3187, 4096, 5384, 5934
PspOMI GGGCCC 1 cut(s) 5382
PspPPI RGGWCCY 4 cut(s) 1287, 1918, 1942, 3313
PsrI GAACNNNNNNTAC 2 cut(s) 3102, 3134
PstI CTGCAG 3 cut(s) 2687, 2924, 3291
PstNI CAGNNNCTG 3 cut(s) 1346, 1945, 1997
PvuII CAGCTG 3 cut(s) 923, 2329, 5228
RseI CAYNNNNRTG 7 cut(s) 184, 378, 1413, 1898, 3897, 4170, 4581
SacI GAGCTC 3 cut(s) 465, 1836, 5159
SapI GCTCTTC 6 cut(s) 289, 2979, 3828, 4101, 4917, 5164
ScaI AGTACT 2 cut(s) 1428, 5598
ScrFI CCNGG 4 cut(s) 1491, 3158, 3311, 5490
SduI GDGCHC 8 cut(s) 284, 465, 835, 1836, 1879, 4503, 5159, 5386
SfcI CTRYAG 7 cut(s) 633, 1851, 2372, 2683, 2831, 2920, 3287
SfuI TTCGAA 1 cut(s) 5318
SinI GGWCC 8 cut(s) 819, 1287, 1903, 1918, 1942, 3313, 3571, 3622
SmiMI CAYNNNNRTG 7 cut(s) 184, 378, 1413, 1898, 3897, 4170, 4581
SsiI CCGC 6 cut(s) 90, 607, 1898, 3320, 4730, 5908
SspI AATATT 2 cut(s) 2839, 4493
SstI GAGCTC 3 cut(s) 465, 1836, 5159
StyD4I CCNGG 4 cut(s) 1489, 3156, 3309, 5488
StyI CCWWGG 8 cut(s) 276, 301, 757, 1827, 2382, 2487, 2952, 4470
TaiI ACGT 5 cut(s) 491, 805, 3499, 5334, 5349
TaqI TCGA 7 cut(s) 5, 772, 1836, 5046, 5318, 5881, 5915
TauI GCSGC 1 cut(s) 4732
TscAI CASTG 9 cut(s) 369, 523, 682, 829, 2929, 4529, 4575, 5581, 5706
TseFI GTSAC 7 cut(s) 271, 1500, 2260, 2809, 4139, 4432, 5342
Tsp45I GTSAC 7 cut(s) 271, 1500, 2260, 2809, 4139, 4432, 5342
TspGWI ACGGA 1 cut(s) 5202
TspRI CASTG 9 cut(s) 369, 523, 682, 829, 2929, 4529, 4575, 5581, 5706
Van91I CCANNNNNTGG 5 cut(s) 828, 1346, 2464, 2569, 3025
Vha464I CTTAAG 4 cut(s) 719, 944, 4753, 5392
VpaK11BI GGWCC 8 cut(s) 819, 1287, 1903, 1918, 1942, 3313, 3571, 3622
VspI ATTAAT 2 cut(s) 4238, 5036
XagI CCTNNNNNAGG 1 cut(s) 3320
XbaI TCTAGA 1 cut(s) 3592
XceI RCATGY 4 cut(s) 183, 404, 2083, 5746
XmiI GTMKAC 2 cut(s) 898, 2830
XmnI GAANNNNTTC 4 cut(s) 618, 2475, 2988, 5109
ZrmI AGTACT 2 cut(s) 1428, 5598
Zsp2I ATGCAT 5 cut(s) 1956, 4041, 4578, 5587, 5799
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.