Rmu_sc0005056.1_g000014

High mobility group B protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005056.1
Physical Location & Seq
Reverse (-)
70575 .. 72547
1973 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005056.1_g000014.1.cds

Sequence Viewer

Length: 507 bp
atgaaggctgccaaaggcaaaggaactgtgaagaaggacaagaaagaagtattgaagcctgttgacgacagaaaggtgggaaagcgaaaggcagtggctgaggttaacaagagtagcggaaaattggccaagaactcaaaatcggccaaaaaggaccctaacaaaccaaagaagcctgctagtgctttttttgtttttcttgaagagttcagaataacttacaagcaagagcacccgaatgtgaaagctgtgtcagctgtggggaaagctggcggagcaaagtggaaatctatgtctgctgcagagaaagctccatatgaagccaaagcagctaaaaggaaaacggagtatgaaaaacttatgaatgcctacaacactaaacaggaggatacggatggtgatgatgatgaagaacctgaaaaaccaaaagccagcgtgacccatgaagatgaggagagtggggaggaagatgatgaagatgacgatgatgaggatgatgaagattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

168

Amino Acids

18.65

Weight (kDa)

5.67

Isoelectric Point (pI)

33.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 117, 273
AcoI YGGCCR 2 cut(s) 126, 144
AgsI TTSAA 2 cut(s) 55, 203
AluBI AGCT 5 cut(s) 248, 257, 269, 311, 332
AluI AGCT 5 cut(s) 248, 257, 269, 311, 332
Alw21I GWGCWC 1 cut(s) 234
AlwNI CAGNNNCTG 1 cut(s) 98
AoxI GGCC 2 cut(s) 126, 144
ApeKI GCWGC 3 cut(s) 8, 299, 329
AspS9I GGNCC 1 cut(s) 154
AsuHPI GGTGA 1 cut(s) 410
AvaII GGWCC 1 cut(s) 154
BalI TGGCCA 1 cut(s) 128
Bbv12I GWGCWC 1 cut(s) 234
BbvCI CCTCAGC 1 cut(s) 99
BbvI GCAGC 2 cut(s) 286, 341
BccI CCATC 1 cut(s) 389
BciVI GTATCC 1 cut(s) 382
BfaI CTAG 1 cut(s) 180
BfmI CTRYAG 1 cut(s) 300
BfuI GTATCC 1 cut(s) 382
BisI GCNGC 3 cut(s) 9, 300, 330
BlsI GCNGC 3 cut(s) 10, 301, 331
Bme18I GGWCC 1 cut(s) 154
BmgT120I GGNCC 1 cut(s) 154
BmiI GGNNCC 1 cut(s) 156
Bpu10I CCTNAGC 1 cut(s) 99
BseGI GGATG 2 cut(s) 400, 499
BseMII CTCAG 1 cut(s) 90
BseRI GAGGAG 1 cut(s) 467
BseXI GCAGC 2 cut(s) 286, 341
BshFI GGCC 2 cut(s) 128, 146
BsiHKAI GWGCWC 1 cut(s) 234
BsmI GAATGC 1 cut(s) 370
BsnI GGCC 2 cut(s) 128, 146
Bsp1286I GDGCHC 1 cut(s) 234
BspACI CCGC 2 cut(s) 117, 273
BspANI GGCC 2 cut(s) 128, 146
BspCNI CTCAG 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 156
BspMAI CTGCAG 1 cut(s) 304
Bst4CI ACNGT 1 cut(s) 28
Bst6I CTCTTC 1 cut(s) 198
BstC8I GCNNGC 3 cut(s) 177, 271, 433
BstDEI CTNAG 1 cut(s) 99
BstF5I GGATG 2 cut(s) 400, 499
BstMWI GCNNNNNNNGC 4 cut(s) 254, 275, 308, 329
BstSFI CTRYAG 1 cut(s) 300
BstV1I GCAGC 2 cut(s) 286, 341
BsuI GTATCC 1 cut(s) 382
BsuRI GGCC 2 cut(s) 128, 146
BtsCI GGATG 2 cut(s) 400, 499
BtsI GCAGTG 1 cut(s) 99
BtsIMutI CAGTG 1 cut(s) 99
Cac8I GCNNGC 3 cut(s) 177, 271, 433
CaiI CAGNNNCTG 1 cut(s) 98
Cfr13I GGNCC 1 cut(s) 154
CviAII CATG 1 cut(s) 443
DdeI CTNAG 1 cut(s) 99
EaeI YGGCCR 2 cut(s) 126, 144
Eam1104I CTCTTC 1 cut(s) 198
EarI CTCTTC 1 cut(s) 198
EciI GGCGGA 1 cut(s) 288
Eco47I GGWCC 1 cut(s) 154
EcoO109I RGGNCCY 1 cut(s) 154
FaeI CATG 1 cut(s) 446
FaiI YATR 6 cut(s) 293, 316, 318, 351, 362, 444
FatI CATG 1 cut(s) 442
FauNDI CATATG 1 cut(s) 316
Fnu4HI GCNGC 3 cut(s) 9, 300, 330
FokI GGATG 1 cut(s) 407
Fsp4HI GCNGC 3 cut(s) 9, 300, 330
FspBI CTAG 1 cut(s) 180
GluI GCNGC 3 cut(s) 9, 300, 330
HaeIII GGCC 2 cut(s) 128, 146
Hin1II CATG 1 cut(s) 446
HincII GTYRAC 2 cut(s) 64, 106
HindII GTYRAC 2 cut(s) 64, 106
HpaI GTTAAC 1 cut(s) 106
HphI GGTGA 1 cut(s) 410
Hpy166II GTNNAC 2 cut(s) 64, 106
Hpy188I TCNGA 1 cut(s) 212
Hpy188III TCNNGA 1 cut(s) 200
Hpy8I GTNNAC 2 cut(s) 64, 106
HpyAV CCTTC 1 cut(s) 28
HpyCH4III ACNGT 1 cut(s) 28
HpyCH4V TGCA 1 cut(s) 302
HpyF10VI GCNNNNNNNGC 4 cut(s) 254, 275, 308, 329
HpyF3I CTNAG 1 cut(s) 99
Hsp92II CATG 1 cut(s) 446
KspAI GTTAAC 1 cut(s) 106
LmnI GCTCC 2 cut(s) 275, 316
LpnPI CCDG 6 cut(s) 72, 189, 255, 368, 429, 445
Lsp1109I GCAGC 2 cut(s) 286, 341
MaeI CTAG 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 436
MboII GAAGA 6 cut(s) 43, 215, 422, 458, 479, 488
MhlI GDGCHC 1 cut(s) 234
MlsI TGGCCA 1 cut(s) 128
MluCI AATT 1 cut(s) 122
MluNI TGGCCA 1 cut(s) 128
MnlI CCTC 5 cut(s) 94, 379, 445, 457, 484
Mox20I TGGCCA 1 cut(s) 128
MscI TGGCCA 1 cut(s) 128
MseI TTAA 1 cut(s) 105
MslI CAYNNNNRTG 2 cut(s) 237, 447
Msp20I TGGCCA 1 cut(s) 128
MspA1I CMGCKG 1 cut(s) 257
Mva1269I GAATGC 1 cut(s) 370
MwoI GCNNNNNNNGC 4 cut(s) 254, 275, 308, 329
NdeI CATATG 1 cut(s) 316
NlaIII CATG 1 cut(s) 446
NlaIV GGNNCC 1 cut(s) 156
NmuCI GTSAC 1 cut(s) 436
PctI GAATGC 1 cut(s) 370
PkrI GCNGC 3 cut(s) 10, 301, 331
PpuMI RGGWCCY 1 cut(s) 154
Psp5II RGGWCCY 1 cut(s) 154
PspN4I GGNNCC 1 cut(s) 156
PspPI GGNCC 1 cut(s) 154
PspPPI RGGWCCY 1 cut(s) 154
PstI CTGCAG 1 cut(s) 304
PstNI CAGNNNCTG 1 cut(s) 98
PvuII CAGCTG 1 cut(s) 257
RseI CAYNNNNRTG 2 cut(s) 237, 447
SaqAI TTAA 1 cut(s) 105
SatI GCNGC 3 cut(s) 9, 300, 330
Sau96I GGNCC 1 cut(s) 154
SduI GDGCHC 1 cut(s) 234
SetI ASST 8 cut(s) 78, 105, 250, 259, 271, 313, 334, 418
SfcI CTRYAG 1 cut(s) 300
SinI GGWCC 1 cut(s) 154
SmiMI CAYNNNNRTG 2 cut(s) 237, 447
Sse9I AATT 1 cut(s) 122
SsiI CCGC 2 cut(s) 117, 273
SspMI CTAG 1 cut(s) 180
TaaI ACNGT 1 cut(s) 28
TasI AATT 1 cut(s) 122
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TscAI CASTG 1 cut(s) 99
TseFI GTSAC 1 cut(s) 436
TseI GCWGC 3 cut(s) 8, 299, 329
Tsp45I GTSAC 1 cut(s) 436
TspDTI ATGAA 7 cut(s) 17, 333, 366, 377, 423, 459, 489
TspGWI ACGGA 2 cut(s) 359, 407
TspRI CASTG 1 cut(s) 99
VpaK11BI GGWCC 1 cut(s) 154
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.