Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005285.1

Orthogroup ID

OG0005452

Physical Location & Seq

Genomic Coordinates Reverse (-)

30099 .. 30479

Gene Structure 381 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005285.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 381 bp

atggcaacagcctcagcaacagtctcaccagcaatgttcaccaccactaccacagtggccaagtctatgaggaaaccatcaaataatgtgcattacatttcaggagtcaattccttttctggactcaaggctcacaatagtgtggccactcttggtcttcctcagtgtactcatcaatcctttgctaagattgtgagctccttaagaactccatcgcagaacaagggcagaggtggaggtgcactatcatctacctgcaatgcagttggtgagattttcaagattgcagccatcatgaatggactcactcttgttggagttgcagttggatttgtacttctccgaatcgaagcagctgtggaggaggaggcagctgagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PetM

Protein Analysis

126

Amino Acids

12.95

Weight (kDa)

9.44

Isoelectric Point (pI)

42.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005452)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G26500 AT2G26500 AT2G26500
fragaria_vesca	FvH4_1g27200 FvH4_2g07330 FvH4_7g04430
malus_domestica	MD05G1072400.v1.1 MD10G1086700.v1.1
prunus_persica	Prupe.8G112900_v2.0.a1
pyrus_communis	pycom05g06460 pycom10g06920
rosa_chinensis	RchiOBHm_Chr3g0487591
rosa_laevigata	RLG00000014497 RLG00000022998
rosa_multiflora	Rmu_sc0005285.1_g000007 Rmu_sc0012412.1_g000003
rosa_roxburghii	Rroxscaffold_6G00394680 Rroxscaffold_7G00207290
rosa_rugosa	Rorug03G0234300 Rorug05G0591600
rosa_samantha	Rh3AG282900 Rh3BG318700 Rh3CG316800 Rh3DG314800 Rh6BG104000 Rh6CG097300 Rh6DG091000
rosa_wichuraiana	Rw3G025030 Rw6G009350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	263
AcoI	YGGCCR	2 cut(s)	57, 144
AfaI	GTAC	2 cut(s)	169, 336
AflII	CTTAAG	1 cut(s)	202
AgsI	TTSAA	1 cut(s)	280
AleI	CACNNNNGTG	1 cut(s)	138
AluBI	AGCT	3 cut(s)	198, 356, 374
AluI	AGCT	3 cut(s)	198, 356, 374
Alw21I	GWGCWC	2 cut(s)	200, 244
Alw26I	GTCTC	1 cut(s)	28
Alw44I	GTGCAC	1 cut(s)	240
AoxI	GGCC	2 cut(s)	57, 144
ApaLI	GTGCAC	1 cut(s)	240
ApeKI	GCWGC	3 cut(s)	287, 353, 371
AsuHPI	GGTGA	3 cut(s)	18, 31, 281
BaeGI	GKGCMC	1 cut(s)	244
BalI	TGGCCA	2 cut(s)	59, 146
BanII	GRGCYC	1 cut(s)	200
BbsI	GAAGAC	1 cut(s)	149
Bbv12I	GWGCWC	2 cut(s)	200, 244
BbvCI	CCTCAGC	1 cut(s)	13
BbvI	GCAGC	2 cut(s)	299, 365
BccI	CCATC	3 cut(s)	85, 220, 299
BcoDI	GTCTC	1 cut(s)	28
BfrI	CTTAAG	1 cut(s)	202
BfuAI	ACCTGC	1 cut(s)	263
BisI	GCNGC	3 cut(s)	288, 354, 372
BlsI	GCNGC	3 cut(s)	289, 355, 373
BpiI	GAAGAC	1 cut(s)	149
Bpu10I	CCTNAGC	1 cut(s)	13
BpuEI	CTTGAG	1 cut(s)	110
BsaXI	ACNNNNNCTCC	2 cut(s)	309, 339
Bse3DI	GCAATG	2 cut(s)	39, 265
BseMI	GCAATG	2 cut(s)	39, 265
BseMII	CTCAG	3 cut(s)	27, 176, 366
BseRI	GAGGAG	2 cut(s)	377, 380
BseSI	GKGCMC	1 cut(s)	244
BseXI	GCAGC	2 cut(s)	299, 365
BshFI	GGCC	2 cut(s)	59, 146
BsiHKAI	GWGCWC	2 cut(s)	200, 244
BsmAI	GTCTC	1 cut(s)	28
BsnI	GGCC	2 cut(s)	59, 146
Bsp1286I	GDGCHC	2 cut(s)	200, 244
BspANI	GGCC	2 cut(s)	59, 146
BspCNI	CTCAG	3 cut(s)	26, 175, 367
BspHI	TCATGA	1 cut(s)	294
BspMI	ACCTGC	1 cut(s)	263
BspTI	CTTAAG	1 cut(s)	202
BsrDI	GCAATG	2 cut(s)	39, 265
Bst4CI	ACNGT	2 cut(s)	22, 55
BstAFI	CTTAAG	1 cut(s)	202
BstDEI	CTNAG	4 cut(s)	13, 162, 186, 375
BstMAI	GTCTC	1 cut(s)	28
BstSLI	GKGCMC	1 cut(s)	244
BstV1I	GCAGC	2 cut(s)	299, 365
BstV2I	GAAGAC	1 cut(s)	149
BsuRI	GGCC	2 cut(s)	59, 146
BtgZI	GCGATG	1 cut(s)	198
BtsIMutI	CAGTG	2 cut(s)	60, 170
BveI	ACCTGC	1 cut(s)	263
CciI	TCATGA	1 cut(s)	294
Csp6I	GTAC	2 cut(s)	168, 335
CviAII	CATG	1 cut(s)	295
CviJI	RGCY	8 cut(s)	11, 59, 131, 146, 198, 290, 356, 374
CviKI_1	RGCY	8 cut(s)	11, 59, 131, 146, 198, 290, 356, 374
CviQI	GTAC	2 cut(s)	168, 335
DdeI	CTNAG	4 cut(s)	13, 162, 186, 375
EaeI	YGGCCR	2 cut(s)	57, 144
Ecl136II	GAGCTC	1 cut(s)	198
Eco24I	GRGCYC	1 cut(s)	200
Eco53kI	GAGCTC	1 cut(s)	198
EcoICRI	GAGCTC	1 cut(s)	198
EcoT38I	GRGCYC	1 cut(s)	200
FaeI	CATG	1 cut(s)	298
FaiI	YATR	2 cut(s)	68, 296
FatI	CATG	1 cut(s)	294
Fnu4HI	GCNGC	3 cut(s)	288, 354, 372
FriOI	GRGCYC	1 cut(s)	200
Fsp4HI	GCNGC	3 cut(s)	288, 354, 372
GluI	GCNGC	3 cut(s)	288, 354, 372
HaeIII	GGCC	2 cut(s)	59, 146
Hin1II	CATG	1 cut(s)	298
HinfI	GANTC	4 cut(s)	105, 123, 303, 345
HphI	GGTGA	3 cut(s)	18, 31, 281
Hpy166II	GTNNAC	3 cut(s)	39, 168, 242
Hpy188I	TCNGA	1 cut(s)	344
Hpy188III	TCNNGA	4 cut(s)	102, 120, 280, 295
Hpy8I	GTNNAC	3 cut(s)	39, 168, 242
HpyCH4III	ACNGT	2 cut(s)	22, 55
HpyCH4V	TGCA	6 cut(s)	91, 242, 258, 263, 287, 323
HpyF3I	CTNAG	4 cut(s)	13, 162, 186, 375
Hsp92II	CATG	1 cut(s)	298
LmnI	GCTCC	1 cut(s)	203
LpnPI	CCDG	4 cut(s)	42, 87, 105, 268
Lsp1109I	GCAGC	2 cut(s)	299, 365
MboII	GAAGA	1 cut(s)	149
MhlI	GDGCHC	2 cut(s)	200, 244
MlsI	TGGCCA	2 cut(s)	59, 146
MluCI	AATT	1 cut(s)	109
MluNI	TGGCCA	2 cut(s)	59, 146
MlyI	GAGTC	3 cut(s)	114, 117, 297
MmeI	TCCRAC	2 cut(s)	295, 307
MnlI	CCTC	8 cut(s)	22, 63, 171, 224, 230, 355, 358, 361
Mox20I	TGGCCA	2 cut(s)	59, 146
MscI	TGGCCA	2 cut(s)	59, 146
MseI	TTAA	1 cut(s)	203
MslI	CAYNNNNRTG	1 cut(s)	138
Msp20I	TGGCCA	2 cut(s)	59, 146
MspA1I	CMGCKG	2 cut(s)	356, 374
MspCI	CTTAAG	1 cut(s)	202
NlaIII	CATG	1 cut(s)	298
OliI	CACNNNNGTG	1 cut(s)	138
PagI	TCATGA	1 cut(s)	294
PfeI	GAWTC	1 cut(s)	345
PkrI	GCNGC	3 cut(s)	289, 355, 373
PleI	GAGTC	3 cut(s)	113, 117, 297
PpsI	GAGTC	3 cut(s)	113, 117, 297
Psp124BI	GAGCTC	1 cut(s)	200
PvuII	CAGCTG	2 cut(s)	356, 374
RsaI	GTAC	2 cut(s)	169, 336
RsaNI	GTAC	2 cut(s)	168, 335
RseI	CAYNNNNRTG	1 cut(s)	138
SacI	GAGCTC	1 cut(s)	200
SaqAI	TTAA	1 cut(s)	203
SatI	GCNGC	3 cut(s)	288, 354, 372
SchI	GAGTC	3 cut(s)	114, 117, 297
SduI	GDGCHC	2 cut(s)	200, 244
SetI	ASST	6 cut(s)	200, 235, 241, 257, 358, 376
SmiMI	CAYNNNNRTG	1 cut(s)	138
SmlI	CTYRAG	2 cut(s)	125, 202
SmoI	CTYRAG	2 cut(s)	125, 202
Sse9I	AATT	1 cut(s)	109
SstI	GAGCTC	1 cut(s)	200
TaaI	ACNGT	2 cut(s)	22, 55
TaqI	TCGA	1 cut(s)	348
TasI	AATT	1 cut(s)	109
TatI	WGTACW	2 cut(s)	167, 334
TfiI	GAWTC	1 cut(s)	345
Tru1I	TTAA	1 cut(s)	203
Tru9I	TTAA	1 cut(s)	203
TscAI	CASTG	2 cut(s)	60, 170
TseI	GCWGC	3 cut(s)	287, 353, 371
TspDTI	ATGAA	1 cut(s)	311
TspRI	CASTG	2 cut(s)	60, 170
Vha464I	CTTAAG	1 cut(s)	202
VneI	GTGCAC	1 cut(s)	240
XcmI	CCANNNNNNNNNTGG	1 cut(s)	52

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.