Rmu_sc0012412.1_g000003

PetM family of cytochrome b6f complex subunit 7

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012412.1
Physical Location & Seq
Forward (+)
20993 .. 21361
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012412.1_g000003.1.cds

Sequence Viewer

Length: 369 bp
atggcagcagtctcaccagcaatgttcaccaccactaccacagtggccaagtctatgaggaaaccatcaaataatgtgcattacatttcaggagtcaattccttttctggactcaaggctcacaatagtgtggccactcttggtcttcctcagtgtactcatcaatcctttgctaagattgtgagctccttaagaactccatcgcagaacaagggcagaggtggaggtgcactatcatctacctgcaatgcagttggtgagattttcaagattgcagccatcatgaatggactcactcttgttggagttgcagttggatttgtacttctccgaatcgaagcagctgtggaggaggaggcagctgagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

12.59

Weight (kDa)

9.44

Isoelectric Point (pI)

44.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 251
AcoI YGGCCR 2 cut(s) 45, 132
AfaI GTAC 2 cut(s) 157, 324
AflII CTTAAG 1 cut(s) 190
AgsI TTSAA 1 cut(s) 268
AleI CACNNNNGTG 1 cut(s) 126
AluBI AGCT 3 cut(s) 186, 344, 362
AluI AGCT 3 cut(s) 186, 344, 362
Alw21I GWGCWC 2 cut(s) 188, 232
Alw26I GTCTC 1 cut(s) 16
Alw44I GTGCAC 1 cut(s) 228
AoxI GGCC 2 cut(s) 45, 132
ApaLI GTGCAC 1 cut(s) 228
ApeKI GCWGC 4 cut(s) 5, 275, 341, 359
AsuHPI GGTGA 3 cut(s) 6, 19, 269
BaeGI GKGCMC 1 cut(s) 232
BalI TGGCCA 2 cut(s) 47, 134
BanII GRGCYC 1 cut(s) 188
BbsI GAAGAC 1 cut(s) 137
Bbv12I GWGCWC 2 cut(s) 188, 232
BbvI GCAGC 3 cut(s) 17, 287, 353
BccI CCATC 3 cut(s) 73, 208, 287
BcoDI GTCTC 1 cut(s) 16
BfrI CTTAAG 1 cut(s) 190
BfuAI ACCTGC 1 cut(s) 251
BisI GCNGC 4 cut(s) 6, 276, 342, 360
BlsI GCNGC 4 cut(s) 7, 277, 343, 361
BpiI GAAGAC 1 cut(s) 137
BpuEI CTTGAG 1 cut(s) 98
BsaXI ACNNNNNCTCC 2 cut(s) 297, 327
Bse3DI GCAATG 2 cut(s) 27, 253
BseMI GCAATG 2 cut(s) 27, 253
BseMII CTCAG 2 cut(s) 164, 354
BseRI GAGGAG 2 cut(s) 365, 368
BseSI GKGCMC 1 cut(s) 232
BseXI GCAGC 3 cut(s) 17, 287, 353
BshFI GGCC 2 cut(s) 47, 134
BsiHKAI GWGCWC 2 cut(s) 188, 232
BsmAI GTCTC 1 cut(s) 16
BsnI GGCC 2 cut(s) 47, 134
Bsp1286I GDGCHC 2 cut(s) 188, 232
BspANI GGCC 2 cut(s) 47, 134
BspCNI CTCAG 2 cut(s) 163, 355
BspHI TCATGA 1 cut(s) 282
BspMI ACCTGC 1 cut(s) 251
BspTI CTTAAG 1 cut(s) 190
BsrDI GCAATG 2 cut(s) 27, 253
Bst4CI ACNGT 1 cut(s) 43
BstAFI CTTAAG 1 cut(s) 190
BstDEI CTNAG 3 cut(s) 150, 174, 363
BstMAI GTCTC 1 cut(s) 16
BstSLI GKGCMC 1 cut(s) 232
BstV1I GCAGC 3 cut(s) 17, 287, 353
BstV2I GAAGAC 1 cut(s) 137
BsuRI GGCC 2 cut(s) 47, 134
BtgZI GCGATG 1 cut(s) 186
BtsIMutI CAGTG 2 cut(s) 48, 158
BveI ACCTGC 1 cut(s) 251
CciI TCATGA 1 cut(s) 282
Csp6I GTAC 2 cut(s) 156, 323
CviAII CATG 1 cut(s) 283
CviJI RGCY 7 cut(s) 47, 119, 134, 186, 278, 344, 362
CviKI_1 RGCY 7 cut(s) 47, 119, 134, 186, 278, 344, 362
CviQI GTAC 2 cut(s) 156, 323
DdeI CTNAG 3 cut(s) 150, 174, 363
EaeI YGGCCR 2 cut(s) 45, 132
Ecl136II GAGCTC 1 cut(s) 186
Eco24I GRGCYC 1 cut(s) 188
Eco53kI GAGCTC 1 cut(s) 186
EcoICRI GAGCTC 1 cut(s) 186
EcoT38I GRGCYC 1 cut(s) 188
FaeI CATG 1 cut(s) 286
FaiI YATR 2 cut(s) 56, 284
FatI CATG 1 cut(s) 282
Fnu4HI GCNGC 4 cut(s) 6, 276, 342, 360
FriOI GRGCYC 1 cut(s) 188
Fsp4HI GCNGC 4 cut(s) 6, 276, 342, 360
GluI GCNGC 4 cut(s) 6, 276, 342, 360
HaeIII GGCC 2 cut(s) 47, 134
Hin1II CATG 1 cut(s) 286
HinfI GANTC 4 cut(s) 93, 111, 291, 333
HphI GGTGA 3 cut(s) 6, 19, 269
Hpy166II GTNNAC 3 cut(s) 27, 156, 230
Hpy188I TCNGA 1 cut(s) 332
Hpy188III TCNNGA 4 cut(s) 90, 108, 268, 283
Hpy8I GTNNAC 3 cut(s) 27, 156, 230
HpyCH4III ACNGT 1 cut(s) 43
HpyCH4V TGCA 6 cut(s) 79, 230, 246, 251, 275, 311
HpyF3I CTNAG 3 cut(s) 150, 174, 363
Hsp92II CATG 1 cut(s) 286
LmnI GCTCC 1 cut(s) 191
LpnPI CCDG 4 cut(s) 30, 75, 93, 256
Lsp1109I GCAGC 3 cut(s) 17, 287, 353
MboII GAAGA 1 cut(s) 137
MhlI GDGCHC 2 cut(s) 188, 232
MlsI TGGCCA 2 cut(s) 47, 134
MluCI AATT 1 cut(s) 97
MluNI TGGCCA 2 cut(s) 47, 134
MlyI GAGTC 3 cut(s) 102, 105, 285
MmeI TCCRAC 2 cut(s) 283, 295
MnlI CCTC 7 cut(s) 51, 159, 212, 218, 343, 346, 349
Mox20I TGGCCA 2 cut(s) 47, 134
MscI TGGCCA 2 cut(s) 47, 134
MseI TTAA 1 cut(s) 191
MslI CAYNNNNRTG 1 cut(s) 126
Msp20I TGGCCA 2 cut(s) 47, 134
MspA1I CMGCKG 2 cut(s) 344, 362
MspCI CTTAAG 1 cut(s) 190
NlaIII CATG 1 cut(s) 286
OliI CACNNNNGTG 1 cut(s) 126
PagI TCATGA 1 cut(s) 282
PfeI GAWTC 1 cut(s) 333
PkrI GCNGC 4 cut(s) 7, 277, 343, 361
PleI GAGTC 3 cut(s) 101, 105, 285
PpsI GAGTC 3 cut(s) 101, 105, 285
Psp124BI GAGCTC 1 cut(s) 188
PvuII CAGCTG 2 cut(s) 344, 362
RsaI GTAC 2 cut(s) 157, 324
RsaNI GTAC 2 cut(s) 156, 323
RseI CAYNNNNRTG 1 cut(s) 126
SacI GAGCTC 1 cut(s) 188
SaqAI TTAA 1 cut(s) 191
SatI GCNGC 4 cut(s) 6, 276, 342, 360
SchI GAGTC 3 cut(s) 102, 105, 285
SduI GDGCHC 2 cut(s) 188, 232
SetI ASST 6 cut(s) 188, 223, 229, 245, 346, 364
SmiMI CAYNNNNRTG 1 cut(s) 126
SmlI CTYRAG 2 cut(s) 113, 190
SmoI CTYRAG 2 cut(s) 113, 190
Sse9I AATT 1 cut(s) 97
SstI GAGCTC 1 cut(s) 188
TaaI ACNGT 1 cut(s) 43
TaqI TCGA 1 cut(s) 336
TasI AATT 1 cut(s) 97
TatI WGTACW 2 cut(s) 155, 322
TfiI GAWTC 1 cut(s) 333
Tru1I TTAA 1 cut(s) 191
Tru9I TTAA 1 cut(s) 191
TscAI CASTG 2 cut(s) 48, 158
TseI GCWGC 4 cut(s) 5, 275, 341, 359
TspDTI ATGAA 1 cut(s) 299
TspRI CASTG 2 cut(s) 48, 158
Vha464I CTTAAG 1 cut(s) 190
VneI GTGCAC 1 cut(s) 228
XcmI CCANNNNNNNNNTGG 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.