Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012412.1

Orthogroup ID

OG0005452

Physical Location & Seq

Genomic Coordinates Forward (+)

20993 .. 21361

Gene Structure 369 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012412.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 369 bp

atggcagcagtctcaccagcaatgttcaccaccactaccacagtggccaagtctatgaggaaaccatcaaataatgtgcattacatttcaggagtcaattccttttctggactcaaggctcacaatagtgtggccactcttggtcttcctcagtgtactcatcaatcctttgctaagattgtgagctccttaagaactccatcgcagaacaagggcagaggtggaggtgcactatcatctacctgcaatgcagttggtgagattttcaagattgcagccatcatgaatggactcactcttgttggagttgcagttggatttgtacttctccgaatcgaagcagctgtggaggaggaggcagctgagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PetM

Protein Analysis

122

Amino Acids

12.59

Weight (kDa)

9.44

Isoelectric Point (pI)

44.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005452)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G26500 AT2G26500 AT2G26500
fragaria_vesca	FvH4_1g27200 FvH4_2g07330 FvH4_7g04430
malus_domestica	MD05G1072400.v1.1 MD10G1086700.v1.1
prunus_persica	Prupe.8G112900_v2.0.a1
pyrus_communis	pycom05g06460 pycom10g06920
rosa_chinensis	RchiOBHm_Chr3g0487591
rosa_laevigata	RLG00000014497 RLG00000022998
rosa_multiflora	Rmu_sc0005285.1_g000007 Rmu_sc0012412.1_g000003
rosa_roxburghii	Rroxscaffold_6G00394680 Rroxscaffold_7G00207290
rosa_rugosa	Rorug03G0234300 Rorug05G0591600
rosa_samantha	Rh3AG282900 Rh3BG318700 Rh3CG316800 Rh3DG314800 Rh6BG104000 Rh6CG097300 Rh6DG091000
rosa_wichuraiana	Rw3G025030 Rw6G009350

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	251
AcoI	YGGCCR	2 cut(s)	45, 132
AfaI	GTAC	2 cut(s)	157, 324
AflII	CTTAAG	1 cut(s)	190
AgsI	TTSAA	1 cut(s)	268
AleI	CACNNNNGTG	1 cut(s)	126
AluBI	AGCT	3 cut(s)	186, 344, 362
AluI	AGCT	3 cut(s)	186, 344, 362
Alw21I	GWGCWC	2 cut(s)	188, 232
Alw26I	GTCTC	1 cut(s)	16
Alw44I	GTGCAC	1 cut(s)	228
AoxI	GGCC	2 cut(s)	45, 132
ApaLI	GTGCAC	1 cut(s)	228
ApeKI	GCWGC	4 cut(s)	5, 275, 341, 359
AsuHPI	GGTGA	3 cut(s)	6, 19, 269
BaeGI	GKGCMC	1 cut(s)	232
BalI	TGGCCA	2 cut(s)	47, 134
BanII	GRGCYC	1 cut(s)	188
BbsI	GAAGAC	1 cut(s)	137
Bbv12I	GWGCWC	2 cut(s)	188, 232
BbvI	GCAGC	3 cut(s)	17, 287, 353
BccI	CCATC	3 cut(s)	73, 208, 287
BcoDI	GTCTC	1 cut(s)	16
BfrI	CTTAAG	1 cut(s)	190
BfuAI	ACCTGC	1 cut(s)	251
BisI	GCNGC	4 cut(s)	6, 276, 342, 360
BlsI	GCNGC	4 cut(s)	7, 277, 343, 361
BpiI	GAAGAC	1 cut(s)	137
BpuEI	CTTGAG	1 cut(s)	98
BsaXI	ACNNNNNCTCC	2 cut(s)	297, 327
Bse3DI	GCAATG	2 cut(s)	27, 253
BseMI	GCAATG	2 cut(s)	27, 253
BseMII	CTCAG	2 cut(s)	164, 354
BseRI	GAGGAG	2 cut(s)	365, 368
BseSI	GKGCMC	1 cut(s)	232
BseXI	GCAGC	3 cut(s)	17, 287, 353
BshFI	GGCC	2 cut(s)	47, 134
BsiHKAI	GWGCWC	2 cut(s)	188, 232
BsmAI	GTCTC	1 cut(s)	16
BsnI	GGCC	2 cut(s)	47, 134
Bsp1286I	GDGCHC	2 cut(s)	188, 232
BspANI	GGCC	2 cut(s)	47, 134
BspCNI	CTCAG	2 cut(s)	163, 355
BspHI	TCATGA	1 cut(s)	282
BspMI	ACCTGC	1 cut(s)	251
BspTI	CTTAAG	1 cut(s)	190
BsrDI	GCAATG	2 cut(s)	27, 253
Bst4CI	ACNGT	1 cut(s)	43
BstAFI	CTTAAG	1 cut(s)	190
BstDEI	CTNAG	3 cut(s)	150, 174, 363
BstMAI	GTCTC	1 cut(s)	16
BstSLI	GKGCMC	1 cut(s)	232
BstV1I	GCAGC	3 cut(s)	17, 287, 353
BstV2I	GAAGAC	1 cut(s)	137
BsuRI	GGCC	2 cut(s)	47, 134
BtgZI	GCGATG	1 cut(s)	186
BtsIMutI	CAGTG	2 cut(s)	48, 158
BveI	ACCTGC	1 cut(s)	251
CciI	TCATGA	1 cut(s)	282
Csp6I	GTAC	2 cut(s)	156, 323
CviAII	CATG	1 cut(s)	283
CviJI	RGCY	7 cut(s)	47, 119, 134, 186, 278, 344, 362
CviKI_1	RGCY	7 cut(s)	47, 119, 134, 186, 278, 344, 362
CviQI	GTAC	2 cut(s)	156, 323
DdeI	CTNAG	3 cut(s)	150, 174, 363
EaeI	YGGCCR	2 cut(s)	45, 132
Ecl136II	GAGCTC	1 cut(s)	186
Eco24I	GRGCYC	1 cut(s)	188
Eco53kI	GAGCTC	1 cut(s)	186
EcoICRI	GAGCTC	1 cut(s)	186
EcoT38I	GRGCYC	1 cut(s)	188
FaeI	CATG	1 cut(s)	286
FaiI	YATR	2 cut(s)	56, 284
FatI	CATG	1 cut(s)	282
Fnu4HI	GCNGC	4 cut(s)	6, 276, 342, 360
FriOI	GRGCYC	1 cut(s)	188
Fsp4HI	GCNGC	4 cut(s)	6, 276, 342, 360
GluI	GCNGC	4 cut(s)	6, 276, 342, 360
HaeIII	GGCC	2 cut(s)	47, 134
Hin1II	CATG	1 cut(s)	286
HinfI	GANTC	4 cut(s)	93, 111, 291, 333
HphI	GGTGA	3 cut(s)	6, 19, 269
Hpy166II	GTNNAC	3 cut(s)	27, 156, 230
Hpy188I	TCNGA	1 cut(s)	332
Hpy188III	TCNNGA	4 cut(s)	90, 108, 268, 283
Hpy8I	GTNNAC	3 cut(s)	27, 156, 230
HpyCH4III	ACNGT	1 cut(s)	43
HpyCH4V	TGCA	6 cut(s)	79, 230, 246, 251, 275, 311
HpyF3I	CTNAG	3 cut(s)	150, 174, 363
Hsp92II	CATG	1 cut(s)	286
LmnI	GCTCC	1 cut(s)	191
LpnPI	CCDG	4 cut(s)	30, 75, 93, 256
Lsp1109I	GCAGC	3 cut(s)	17, 287, 353
MboII	GAAGA	1 cut(s)	137
MhlI	GDGCHC	2 cut(s)	188, 232
MlsI	TGGCCA	2 cut(s)	47, 134
MluCI	AATT	1 cut(s)	97
MluNI	TGGCCA	2 cut(s)	47, 134
MlyI	GAGTC	3 cut(s)	102, 105, 285
MmeI	TCCRAC	2 cut(s)	283, 295
MnlI	CCTC	7 cut(s)	51, 159, 212, 218, 343, 346, 349
Mox20I	TGGCCA	2 cut(s)	47, 134
MscI	TGGCCA	2 cut(s)	47, 134
MseI	TTAA	1 cut(s)	191
MslI	CAYNNNNRTG	1 cut(s)	126
Msp20I	TGGCCA	2 cut(s)	47, 134
MspA1I	CMGCKG	2 cut(s)	344, 362
MspCI	CTTAAG	1 cut(s)	190
NlaIII	CATG	1 cut(s)	286
OliI	CACNNNNGTG	1 cut(s)	126
PagI	TCATGA	1 cut(s)	282
PfeI	GAWTC	1 cut(s)	333
PkrI	GCNGC	4 cut(s)	7, 277, 343, 361
PleI	GAGTC	3 cut(s)	101, 105, 285
PpsI	GAGTC	3 cut(s)	101, 105, 285
Psp124BI	GAGCTC	1 cut(s)	188
PvuII	CAGCTG	2 cut(s)	344, 362
RsaI	GTAC	2 cut(s)	157, 324
RsaNI	GTAC	2 cut(s)	156, 323
RseI	CAYNNNNRTG	1 cut(s)	126
SacI	GAGCTC	1 cut(s)	188
SaqAI	TTAA	1 cut(s)	191
SatI	GCNGC	4 cut(s)	6, 276, 342, 360
SchI	GAGTC	3 cut(s)	102, 105, 285
SduI	GDGCHC	2 cut(s)	188, 232
SetI	ASST	6 cut(s)	188, 223, 229, 245, 346, 364
SmiMI	CAYNNNNRTG	1 cut(s)	126
SmlI	CTYRAG	2 cut(s)	113, 190
SmoI	CTYRAG	2 cut(s)	113, 190
Sse9I	AATT	1 cut(s)	97
SstI	GAGCTC	1 cut(s)	188
TaaI	ACNGT	1 cut(s)	43
TaqI	TCGA	1 cut(s)	336
TasI	AATT	1 cut(s)	97
TatI	WGTACW	2 cut(s)	155, 322
TfiI	GAWTC	1 cut(s)	333
Tru1I	TTAA	1 cut(s)	191
Tru9I	TTAA	1 cut(s)	191
TscAI	CASTG	2 cut(s)	48, 158
TseI	GCWGC	4 cut(s)	5, 275, 341, 359
TspDTI	ATGAA	1 cut(s)	299
TspRI	CASTG	2 cut(s)	48, 158
Vha464I	CTTAAG	1 cut(s)	190
VneI	GTGCAC	1 cut(s)	228
XcmI	CCANNNNNNNNNTGG	1 cut(s)	40

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.