Rmu_sc0005510.1_g000001

belongs to the flavoprotein pyridine nucleotide cytochrome reductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005510.1
Physical Location & Seq
Forward (+)
1 .. 897
897 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005510.1_g000001.1.cds

Sequence Viewer

Length: 394 bp
tggtataactcctatgcttcaggtcattgaggctatacttaaaaatcctgatgacacaaccaaggtgtcgctggtttatgctaatgtctcaccagatgacatactgcttaaacagaaacttgacatacttgcagctagccaccctaatttgaaggtgttttacacagtagataatccaacaaagagttggaaaggaggtaaaggctacatatcaaaggacatggcaattaaaggcttacctggtccagctgaagatactctcatctttgtatgcggtcctcctggaatgatggaacacatatctggtggcaaggctaaagactattcacaaggagagctcaggggcatactaaaagaacttggttacacagaagaaatggtttacaaattttga

Protein Analysis

130

Amino Acids

14.22

Weight (kDa)

6.13

Isoelectric Point (pI)

28.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 274
AcsI RAATTY 1 cut(s) 387
AcuI CTGAAG 1 cut(s) 271
AgsI TTSAA 1 cut(s) 152
AjnI CCWGG 2 cut(s) 239, 281
AluBI AGCT 3 cut(s) 135, 249, 338
AluI AGCT 3 cut(s) 135, 249, 338
Alw21I GWGCWC 1 cut(s) 340
Alw26I GTCTC 1 cut(s) 92
ApeKI GCWGC 1 cut(s) 132
ApoI RAATTY 1 cut(s) 387
AspS9I GGNCC 2 cut(s) 243, 276
AsuHPI GGTGA 1 cut(s) 82
AsuNHI GCTAGC 1 cut(s) 135
AvaII GGWCC 2 cut(s) 243, 276
BanII GRGCYC 1 cut(s) 340
BarI GAAGNNNNNNTAC 2 cut(s) 144, 176
Bbv12I GWGCWC 1 cut(s) 340
BbvI GCAGC 1 cut(s) 144
BccI CCATC 1 cut(s) 284
BciT130I CCWGG 2 cut(s) 241, 283
BcoDI GTCTC 1 cut(s) 92
BfaI CTAG 1 cut(s) 136
BisI GCNGC 1 cut(s) 133
BlsI GCNGC 1 cut(s) 134
Bme1390I CCNGG 2 cut(s) 241, 283
Bme18I GGWCC 2 cut(s) 243, 276
BmgT120I GGNCC 2 cut(s) 243, 276
BmrFI CCNGG 2 cut(s) 241, 283
BmtI GCTAGC 1 cut(s) 139
Bpu10I CCTNAGC 1 cut(s) 339
BsaJI CCNNGG 1 cut(s) 61
BseBI CCWGG 2 cut(s) 241, 283
BseDI CCNNGG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 353
BseXI GCAGC 1 cut(s) 144
BsiHKAI GWGCWC 1 cut(s) 340
BsmAI GTCTC 1 cut(s) 92
Bsp1286I GDGCHC 1 cut(s) 340
BspACI CCGC 1 cut(s) 274
BspCNI CTCAG 1 cut(s) 352
BspOI GCTAGC 1 cut(s) 139
BssECI CCNNGG 1 cut(s) 61
BssT1I CCWWGG 1 cut(s) 61
Bst2UI CCWGG 2 cut(s) 241, 283
Bst4CI ACNGT 1 cut(s) 167
BstC8I GCNNGC 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 339
BstMAI GTCTC 1 cut(s) 92
BstNI CCWGG 2 cut(s) 241, 283
BstSCI CCNGG 2 cut(s) 239, 281
BstV1I GCAGC 1 cut(s) 144
Cac8I GCNNGC 1 cut(s) 137
Cfr13I GGNCC 2 cut(s) 243, 276
CsiI ACCWGGT 1 cut(s) 239
CviAII CATG 1 cut(s) 221
CviJI RGCY 8 cut(s) 33, 135, 139, 205, 235, 249, 315, 338
CviKI_1 RGCY 8 cut(s) 33, 135, 139, 205, 235, 249, 315, 338
DdeI CTNAG 1 cut(s) 339
Ecl136II GAGCTC 1 cut(s) 338
Eco130I CCWWGG 1 cut(s) 61
Eco24I GRGCYC 1 cut(s) 340
Eco47I GGWCC 2 cut(s) 243, 276
Eco53kI GAGCTC 1 cut(s) 338
Eco57I CTGAAG 1 cut(s) 271
EcoICRI GAGCTC 1 cut(s) 338
EcoRII CCWGG 2 cut(s) 239, 281
EcoT14I CCWWGG 1 cut(s) 61
EcoT38I GRGCYC 1 cut(s) 340
ErhI CCWWGG 1 cut(s) 61
FaeI CATG 1 cut(s) 224
FatI CATG 1 cut(s) 220
Fnu4HI GCNGC 1 cut(s) 133
FriOI GRGCYC 1 cut(s) 340
Fsp4HI GCNGC 1 cut(s) 133
FspBI CTAG 1 cut(s) 136
GluI GCNGC 1 cut(s) 133
Hin1II CATG 1 cut(s) 224
HphI GGTGA 1 cut(s) 82
Hpy166II GTNNAC 1 cut(s) 383
Hpy188III TCNNGA 1 cut(s) 48
Hpy8I GTNNAC 1 cut(s) 383
HpyAV CCTTC 1 cut(s) 146
HpyCH4III ACNGT 1 cut(s) 167
HpyCH4V TGCA 1 cut(s) 132
HpyF3I CTNAG 1 cut(s) 339
Hsp92II CATG 1 cut(s) 224
Lsp1109I GCAGC 1 cut(s) 144
MabI ACCWGGT 1 cut(s) 239
MaeI CTAG 1 cut(s) 136
MaeIII GTNAC 1 cut(s) 363
MboII GAAGA 2 cut(s) 264, 384
MhlI GDGCHC 1 cut(s) 340
MluCI AATT 3 cut(s) 146, 226, 387
MmeI TCCRAC 2 cut(s) 168, 201
MnlI CCTC 3 cut(s) 23, 189, 289
MseI TTAA 3 cut(s) 40, 109, 229
MspA1I CMGCKG 1 cut(s) 249
MspR9I CCNGG 2 cut(s) 241, 283
MvaI CCWGG 2 cut(s) 241, 283
NheI GCTAGC 1 cut(s) 135
NlaIII CATG 1 cut(s) 224
PfoI TCCNGGA 1 cut(s) 281
PkrI GCNGC 1 cut(s) 134
Psp124BI GAGCTC 1 cut(s) 340
Psp6I CCWGG 2 cut(s) 239, 281
PspGI CCWGG 2 cut(s) 239, 281
PspPI GGNCC 2 cut(s) 243, 276
PvuII CAGCTG 1 cut(s) 249
SacI GAGCTC 1 cut(s) 340
SaqAI TTAA 3 cut(s) 40, 109, 229
SatI GCNGC 1 cut(s) 133
Sau96I GGNCC 2 cut(s) 243, 276
ScrFI CCNGG 2 cut(s) 241, 283
SduI GDGCHC 1 cut(s) 340
SetI ASST 8 cut(s) 25, 67, 137, 157, 200, 242, 251, 340
SexAI ACCWGGT 1 cut(s) 239
SinI GGWCC 2 cut(s) 243, 276
Sse9I AATT 3 cut(s) 146, 226, 387
SsiI CCGC 1 cut(s) 274
SspMI CTAG 1 cut(s) 136
SstI GAGCTC 1 cut(s) 340
StyD4I CCNGG 2 cut(s) 239, 281
StyI CCWWGG 1 cut(s) 61
TaaI ACNGT 1 cut(s) 167
TasI AATT 3 cut(s) 146, 226, 387
Tru1I TTAA 3 cut(s) 40, 109, 229
Tru9I TTAA 3 cut(s) 40, 109, 229
TseI GCWGC 1 cut(s) 132
VpaK11BI GGWCC 2 cut(s) 243, 276
XapI RAATTY 1 cut(s) 387
XcmI CCANNNNNNNNNTGG 2 cut(s) 68, 184
XspI CTAG 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.