Rmu_sc0005526.1_g000008

Component of the cytosolic iron-sulfur (Fe-S) protein assembly (CIA) machinery. Required for the maturation of extramitochondrial Fe-S proteins. Part of an electron transfer chain functioning in an early step of cytosolic Fe-S biogenesis. Electrons are transferred to the Fe-S cluster from NADPH via a FAD- and FMN-containing diflavin oxidoreductase. Has anti- apoptotic effects in the cell

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005526.1
Physical Location & Seq
Reverse (-)
56204 .. 56773
570 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005526.1_g000008.1.cds

Sequence Viewer

Length: 291 bp
ctgattgatgaggatagtctattaacggaagaggacttgaagaaaccccagccggtcgtagctgatgattgtgaagttggaagcacaaggaaagcttgtaaaaattgcacttgtgggagggctgaagcggagcaaaaagtagagaagttacaatccactgtggatttgagcagtttccagtcagcatgtggcagttgtggactaggggatgctttccgatgcgctacatgtccttataagggtcttcctccattcaaaccgggcgagaaggtagcgttctcttcaaactaa
Functional Annotation

Protein Analysis

96

Amino Acids

10.25

Weight (kDa)

4.9

Isoelectric Point (pI)

57.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 237
AciI CCGC 1 cut(s) 128
AcuI CTGAAG 1 cut(s) 144
AfiI CCNNNNNNNGG 1 cut(s) 239
AflIII ACRYGT 1 cut(s) 227
AgsI TTSAA 3 cut(s) 40, 256, 285
AluBI AGCT 2 cut(s) 62, 95
AluI AGCT 2 cut(s) 62, 95
AspLEI GCGC 1 cut(s) 224
AsuC2I CCSGG 1 cut(s) 261
BbsI GAAGAC 1 cut(s) 236
BcnI CCSGG 1 cut(s) 261
BfaI CTAG 1 cut(s) 203
Bme1390I CCNGG 1 cut(s) 261
BmrFI CCNGG 1 cut(s) 261
BmsI GCATC 2 cut(s) 199, 209
BpiI GAAGAC 1 cut(s) 236
BpuMI CCSGG 1 cut(s) 261
Bsc4I CCNNNNNNNGG 1 cut(s) 239
Bse118I RCCGGY 1 cut(s) 52
Bse1I ACTGG 1 cut(s) 178
BseGI GGATG 1 cut(s) 214
BseLI CCNNNNNNNGG 1 cut(s) 239
BseNI ACTGG 1 cut(s) 178
BseYI CCCAGC 1 cut(s) 48
Bsh1285I CGRYCG 1 cut(s) 57
BsiEI CGRYCG 1 cut(s) 57
BsiSI CCGG 2 cut(s) 53, 260
BslI CCNNNNNNNGG 1 cut(s) 239
BspACI CCGC 1 cut(s) 128
BsrFI RCCGGY 1 cut(s) 52
BsrI ACTGG 1 cut(s) 178
BssAI RCCGGY 1 cut(s) 52
Bst4CI ACNGT 1 cut(s) 160
Bst6I CTCTTC 2 cut(s) 24, 286
BstF5I GGATG 1 cut(s) 214
BstHHI GCGC 1 cut(s) 224
BstMCI CGRYCG 1 cut(s) 57
BstNSI RCATGY 2 cut(s) 189, 231
BstSCI CCNGG 1 cut(s) 259
BstV2I GAAGAC 1 cut(s) 236
BtsCI GGATG 1 cut(s) 214
BtsIMutI CAGTG 1 cut(s) 156
CfoI GCGC 1 cut(s) 224
Cfr10I RCCGGY 1 cut(s) 52
CviAII CATG 2 cut(s) 186, 228
CviJI RGCY 4 cut(s) 52, 62, 95, 122
CviKI_1 RGCY 4 cut(s) 52, 62, 95, 122
Eam1104I CTCTTC 2 cut(s) 24, 286
EarI CTCTTC 2 cut(s) 24, 286
Eco57I CTGAAG 1 cut(s) 144
FaeI CATG 2 cut(s) 189, 231
FaiI YATR 3 cut(s) 187, 229, 237
FalI AAGNNNNNCTT 2 cut(s) 79, 111
FatI CATG 2 cut(s) 185, 227
FokI GGATG 1 cut(s) 221
FspBI CTAG 1 cut(s) 203
GlaI GCGC 1 cut(s) 223
GsaI CCCAGC 1 cut(s) 52
HapII CCGG 2 cut(s) 53, 260
HhaI GCGC 1 cut(s) 224
Hin1II CATG 2 cut(s) 189, 231
Hin6I GCGC 1 cut(s) 222
HinP1I GCGC 1 cut(s) 222
HindIII AAGCTT 1 cut(s) 93
HpaII CCGG 2 cut(s) 53, 260
Hpy166II GTNNAC 1 cut(s) 200
Hpy188I TCNGA 1 cut(s) 218
Hpy8I GTNNAC 1 cut(s) 200
HpyAV CCTTC 1 cut(s) 262
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 1 cut(s) 108
Hsp92II CATG 2 cut(s) 189, 231
HspAI GCGC 1 cut(s) 222
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 4 cut(s) 62, 66, 191, 273
LweI GCATC 2 cut(s) 199, 209
MaeI CTAG 1 cut(s) 203
MaeIII GTNAC 1 cut(s) 147
MboII GAAGA 4 cut(s) 41, 52, 236, 273
MluCI AATT 1 cut(s) 103
MmeI TCCRAC 1 cut(s) 58
MnlI CCTC 4 cut(s) 4, 25, 111, 258
MseI TTAA 1 cut(s) 23
MspI CCGG 2 cut(s) 53, 260
MspR9I CCNGG 1 cut(s) 261
NciI CCSGG 1 cut(s) 261
NlaIII CATG 2 cut(s) 189, 231
NspI RCATGY 2 cut(s) 189, 231
PciI ACATGT 1 cut(s) 227
PscI ACATGT 1 cut(s) 227
PsiI TTATAA 1 cut(s) 237
PspFI CCCAGC 1 cut(s) 48
SaqAI TTAA 1 cut(s) 23
ScrFI CCNGG 1 cut(s) 261
SetI ASST 3 cut(s) 64, 97, 273
SfaNI GCATC 2 cut(s) 199, 209
Sse9I AATT 1 cut(s) 103
SsiI CCGC 1 cut(s) 128
SspMI CTAG 1 cut(s) 203
StyD4I CCNGG 1 cut(s) 259
TaaI ACNGT 1 cut(s) 160
TasI AATT 1 cut(s) 103
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TscAI CASTG 1 cut(s) 163
TspGWI ACGGA 1 cut(s) 41
TspRI CASTG 1 cut(s) 163
XceI RCATGY 2 cut(s) 189, 231
XcmI CCANNNNNNNNNTGG 1 cut(s) 185
XspI CTAG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.