Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005736.1

Orthogroup ID

OG0016429

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 477

Gene Structure 477 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005736.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 197 bp

gggaggtagggagaatgtatgaatccaatgtggatgatgtaggatataggcttgtagccatttacactcctgtaagagaggatggagtggaggggtcacctgtttcagcatcgacagagccgattgcagtcgagcctgatgttcttaaagaagtgaagcagaagcttgatctcagatcagtgaaatttgaggtatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000226 GO:0001578 GO:0001669 GO:0002177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005856 GO:0006996 GO:0007010 GO:0007017 GO:0007276 GO:0007283 GO:0008150 GO:0009987 GO:0012505 GO:0015630 GO:0016043 GO:0019953 GO:0022414 GO:0022607 GO:0030030 GO:0030031 GO:0030141 GO:0031410 GO:0031982 GO:0032501 GO:0032504 GO:0035082 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043232 GO:0044085 GO:0044422 GO:0044424 GO:0044430 GO:0044444 GO:0044446 GO:0044464 GO:0044703 GO:0044782 GO:0048232 GO:0048609 GO:0051704 GO:0060271 GO:0070925 GO:0071840 GO:0097223 GO:0097708 GO:0099503 GO:0120031 GO:0120036

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_4

Protein Analysis

64

Amino Acids

7.11

Weight (kDa)

4.53

Isoelectric Point (pI)

38.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016429)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0313151 RchiOBHm_Chr1g0313161 RchiOBHm_Chr5g0015771
rosa_multiflora	Rmu_sc0005736.1_g000001 Rmu_sc0011343.1_g000003 Rmu_sc0011998.1_g000002 Rmu_sc0014154.1_g000001
rosa_samantha	Rh1AG001200 Rh5AG044600 Rh5BG550000 Rh5CG052200 Rh5CG132700 Rh5CG572900 Rh6AG032400
rosa_wichuraiana	Rw3G028850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	184
AluBI	AGCT	1 cut(s)	165
AluI	AGCT	1 cut(s)	165
ApoI	RAATTY	1 cut(s)	184
AsuHPI	GGTGA	1 cut(s)	89
BccI	CCATC	1 cut(s)	76
BmsI	GCATC	1 cut(s)	118
BseGI	GGATG	2 cut(s)	39, 87
BseMII	CTCAG	1 cut(s)	186
Bsp143I	GATC	2 cut(s)	168, 175
BspCNI	CTCAG	1 cut(s)	185
BssMI	GATC	2 cut(s)	168, 175
BstDEI	CTNAG	1 cut(s)	172
BstEII	GGTNACC	1 cut(s)	95
BstF5I	GGATG	2 cut(s)	39, 87
BstKTI	GATC	2 cut(s)	171, 178
BstMBI	GATC	2 cut(s)	168, 175
BstPI	GGTNACC	1 cut(s)	95
BtsCI	GGATG	2 cut(s)	39, 87
BtsIMutI	CAGTG	1 cut(s)	185
CviJI	RGCY	5 cut(s)	51, 58, 120, 135, 165
CviKI_1	RGCY	5 cut(s)	51, 58, 120, 135, 165
DdeI	CTNAG	1 cut(s)	172
DpnI	GATC	2 cut(s)	170, 177
DpnII	GATC	2 cut(s)	168, 175
Eco91I	GGTNACC	1 cut(s)	95
EcoO65I	GGTNACC	1 cut(s)	95
FaiI	YATR	3 cut(s)	20, 47, 195
FokI	GGATG	2 cut(s)	46, 94
HindIII	AAGCTT	1 cut(s)	163
HinfI	GANTC	1 cut(s)	22
HphI	GGTGA	1 cut(s)	89
Hpy188I	TCNGA	1 cut(s)	175
HpyCH4V	TGCA	1 cut(s)	127
HpyF3I	CTNAG	1 cut(s)	172
Kzo9I	GATC	2 cut(s)	168, 175
LpnPI	CCDG	3 cut(s)	83, 113, 149
LweI	GCATC	1 cut(s)	118
MaeIII	GTNAC	1 cut(s)	95
MalI	GATC	2 cut(s)	170, 177
MboI	GATC	2 cut(s)	168, 175
MluCI	AATT	1 cut(s)	184
MnlI	CCTC	3 cut(s)	72, 84, 183
MseI	TTAA	1 cut(s)	146
NdeII	GATC	2 cut(s)	168, 175
NmuCI	GTSAC	1 cut(s)	95
PcsI	WCGNNNNNNNCGW	1 cut(s)	118
PfeI	GAWTC	1 cut(s)	22
PspEI	GGTNACC	1 cut(s)	95
SaqAI	TTAA	1 cut(s)	146
Sau3AI	GATC	2 cut(s)	168, 175
SetI	ASST	4 cut(s)	8, 102, 167, 194
SfaNI	GCATC	1 cut(s)	118
SgeI	CNNG	6 cut(s)	64, 82, 112, 144, 148, 178
Sse9I	AATT	1 cut(s)	184
TaqI	TCGA	2 cut(s)	112, 131
TasI	AATT	1 cut(s)	184
TfiI	GAWTC	1 cut(s)	22
Tru1I	TTAA	1 cut(s)	146
Tru9I	TTAA	1 cut(s)	146
TscAI	CASTG	1 cut(s)	185
TseFI	GTSAC	1 cut(s)	95
Tsp45I	GTSAC	1 cut(s)	95
TspDTI	ATGAA	1 cut(s)	35
TspRI	CASTG	1 cut(s)	185
XapI	RAATTY	1 cut(s)	184

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.