Rmu_sc0006046.1_g000007

Plant non-specific lipid-transfer proteins transfer phospholipids as well as galactolipids across membranes. May play a role in wax or cutin deposition in the cell walls of expanding epidermal cells and certain secretory tissues

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006046.1
OG0005488
Physical Location & Seq
Reverse (-)
31573 .. 33061
1489 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 558 bp
atggctgatagtcgtctattgggggcaaaaaaactttccagtgagattttcagcaaattcctgtgggcggcagccggtgacggaatcctgcggccggtgaccggaatcccgcagccagtgaccggattcgggcggccggtgaccggactccggcgaagtctcccatgcatattacctacaacgtgggaatcgatggcgttctctagagttctgaaggtgatttgcttggtggtgctatccgtggctgcactgtggtttggtgatgcgaaagcagccattacgtgcggtcaggtggtgaataagctgatgccatgcgttgcctacgtccaaaacggtgggactcccgcggtgggttgctgtagcgggatcaagaccctctacggcatggctcaaaccacccctgaccgccagagcgtgtgcaactgtttgaaacaagcagttgccggaattccgtacaccggagctaacgccggtcttgctgctggccttcccggcaagtgtggtgtcaaccttccctacaagatcaacccttctactgactgcaaaagcatcaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0006810 GO:0006869 GO:0008150 GO:0010876 GO:0016020 GO:0033036 GO:0051179 GO:0051234 GO:0071702
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LTP_2 Tryp_alpha_amyl

Protein Analysis

185

Amino Acids

19.28

Weight (kDa)

9.46

Isoelectric Point (pI)

38.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tryp_alpha_amyl PF00234 95 - 181 1.8e-14 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 347
AciI CCGC 9 cut(s) 68, 91, 110, 133, 285, 345, 347, 363, 406
AclWI GGATC 1 cut(s) 374
AcoI YGGCCR 2 cut(s) 92, 134
AcsI RAATTY 2 cut(s) 56, 447
AcuI CTGAAG 1 cut(s) 233
AfaI GTAC 1 cut(s) 455
AfiI CCNNNNNNNGG 9 cut(s) 67, 94, 101, 122, 129, 143, 150, 350, 458
AgsI TTSAA 1 cut(s) 430
AluBI AGCT 2 cut(s) 304, 464
AluI AGCT 2 cut(s) 304, 464
Alw26I GTCTC 1 cut(s) 164
AlwI GGATC 1 cut(s) 374
AoxI GGCC 3 cut(s) 92, 134, 484
ApeKI GCWGC 5 cut(s) 71, 112, 245, 272, 479
ApoI RAATTY 2 cut(s) 56, 447
AsuC2I CCSGG 1 cut(s) 492
AsuHPI GGTGA 6 cut(s) 89, 109, 151, 229, 272, 307
BbvI GCAGC 5 cut(s) 83, 124, 232, 284, 466
BccI CCATC 1 cut(s) 187
BceAI ACGGC 1 cut(s) 397
BcnI CCSGG 1 cut(s) 492
BcoDI GTCTC 1 cut(s) 164
BfaI CTAG 1 cut(s) 204
BfmI CTRYAG 1 cut(s) 358
BglI GCCNNNNNGGC 1 cut(s) 492
BisI GCNGC 8 cut(s) 69, 72, 92, 113, 134, 246, 273, 480
BlsI GCNGC 8 cut(s) 70, 73, 93, 114, 135, 247, 274, 481
Bme1390I CCNGG 1 cut(s) 492
BmrFI CCNGG 1 cut(s) 492
BmsI GCATC 2 cut(s) 253, 297
BpuMI CCSGG 1 cut(s) 492
Bsa29I ATCGAT 1 cut(s) 191
BsaAI YACGTR 1 cut(s) 282
BsaJI CCNNGG 2 cut(s) 240, 345
BsaWI WCCGGW 4 cut(s) 101, 122, 143, 458
Bsc4I CCNNNNNNNGG 9 cut(s) 67, 94, 101, 122, 129, 143, 150, 350, 458
Bse118I RCCGGY 4 cut(s) 74, 94, 136, 470
Bse1I ACTGG 2 cut(s) 39, 116
BseCI ATCGAT 1 cut(s) 191
BseDI CCNNGG 2 cut(s) 240, 345
BseLI CCNNNNNNNGG 9 cut(s) 67, 94, 101, 122, 129, 143, 150, 350, 458
BseNI ACTGG 2 cut(s) 39, 116
BseX3I CGGCCG 2 cut(s) 92, 134
BseXI GCAGC 5 cut(s) 83, 124, 232, 284, 466
BsgI GTGCAG 1 cut(s) 231
Bsh1236I CGCG 1 cut(s) 347
Bsh1285I CGRYCG 2 cut(s) 95, 137
BshFI GGCC 3 cut(s) 94, 136, 486
BshVI ATCGAT 1 cut(s) 191
BsiEI CGRYCG 2 cut(s) 95, 137
BslFI GGGAC 1 cut(s) 352
BslI CCNNNNNNNGG 9 cut(s) 67, 94, 101, 122, 129, 143, 150, 350, 458
BsmAI GTCTC 1 cut(s) 164
BsmFI GGGAC 1 cut(s) 352
BsnI GGCC 3 cut(s) 94, 136, 486
Bsp143I GATC 2 cut(s) 366, 522
BspACI CCGC 9 cut(s) 68, 91, 110, 133, 285, 345, 347, 363, 406
BspANI GGCC 3 cut(s) 94, 136, 486
BspDI ATCGAT 1 cut(s) 191
BspFNI CGCG 1 cut(s) 347
BspPI GGATC 1 cut(s) 374
BsrFI RCCGGY 4 cut(s) 74, 94, 136, 470
BsrI ACTGG 2 cut(s) 39, 116
BssAI RCCGGY 4 cut(s) 74, 94, 136, 470
BssECI CCNNGG 2 cut(s) 240, 345
BssMI GATC 2 cut(s) 366, 522
Bst4CI ACNGT 3 cut(s) 252, 335, 425
BstBAI YACGTR 1 cut(s) 282
BstC8I GCNNGC 1 cut(s) 484
BstDSI CCRYGG 2 cut(s) 240, 345
BstEII GGTNACC 2 cut(s) 97, 139
BstFNI CGCG 1 cut(s) 347
BstKTI GATC 2 cut(s) 369, 525
BstMAI GTCTC 1 cut(s) 164
BstMBI GATC 2 cut(s) 366, 522
BstMCI CGRYCG 2 cut(s) 95, 137
BstMWI GCNNNNNNNGC 3 cut(s) 272, 476, 492
BstPI GGTNACC 2 cut(s) 97, 139
BstSCI CCNGG 1 cut(s) 490
BstSFI CTRYAG 1 cut(s) 358
BstUI CGCG 1 cut(s) 347
BstV1I GCAGC 5 cut(s) 83, 124, 232, 284, 466
BstXI CCANNNNNNTGG 1 cut(s) 335
BstZI CGGCCG 2 cut(s) 92, 134
Bsu15I ATCGAT 1 cut(s) 191
BsuRI GGCC 3 cut(s) 94, 136, 486
BsuTUI ATCGAT 1 cut(s) 191
BtgI CCRYGG 2 cut(s) 240, 345
BtsIMutI CAGTG 3 cut(s) 46, 123, 248
Cac8I GCNNGC 1 cut(s) 484
Cfr10I RCCGGY 4 cut(s) 74, 94, 136, 470
Cfr42I CCGCGG 1 cut(s) 348
ClaI ATCGAT 1 cut(s) 191
Csp6I GTAC 1 cut(s) 454
CviAII CATG 3 cut(s) 165, 312, 385
CviQI GTAC 1 cut(s) 454
DpnI GATC 2 cut(s) 368, 524
DpnII GATC 2 cut(s) 366, 522
EaeI YGGCCR 2 cut(s) 92, 134
EagI CGGCCG 2 cut(s) 92, 134
EclXI CGGCCG 2 cut(s) 92, 134
Eco52I CGGCCG 2 cut(s) 92, 134
Eco57I CTGAAG 1 cut(s) 233
Eco91I GGTNACC 2 cut(s) 97, 139
EcoO65I GGTNACC 2 cut(s) 97, 139
EcoRI GAATTC 1 cut(s) 447
EcoT22I ATGCAT 1 cut(s) 170
FaeI CATG 3 cut(s) 168, 315, 388
FaiI YATR 4 cut(s) 166, 170, 313, 386
FaqI GGGAC 1 cut(s) 352
FatI CATG 3 cut(s) 164, 311, 384
FauI CCCGC 3 cut(s) 117, 352, 356
Fnu4HI GCNGC 8 cut(s) 69, 72, 92, 113, 134, 246, 273, 480
Fsp4HI GCNGC 8 cut(s) 69, 72, 92, 113, 134, 246, 273, 480
FspBI CTAG 1 cut(s) 204
GluI GCNGC 8 cut(s) 69, 72, 92, 113, 134, 246, 273, 480
HaeIII GGCC 3 cut(s) 94, 136, 486
Hin1II CATG 3 cut(s) 168, 315, 388
HincII GTYRAC 1 cut(s) 508
HindII GTYRAC 1 cut(s) 508
HinfI GANTC 6 cut(s) 84, 105, 126, 147, 188, 340
HphI GGTGA 6 cut(s) 89, 109, 151, 229, 272, 307
Hpy166II GTNNAC 2 cut(s) 456, 508
Hpy188I TCNGA 1 cut(s) 213
Hpy188III TCNNGA 2 cut(s) 204, 370
Hpy8I GTNNAC 2 cut(s) 456, 508
HpyAV CCTTC 4 cut(s) 208, 497, 521, 540
HpyCH4III ACNGT 3 cut(s) 252, 335, 425
HpyCH4IV ACGT 3 cut(s) 182, 281, 324
HpyCH4V TGCA 4 cut(s) 168, 248, 420, 543
HpyF10VI GCNNNNNNNGC 3 cut(s) 272, 476, 492
HpySE526I ACGT 3 cut(s) 182, 281, 324
Hsp92II CATG 3 cut(s) 168, 315, 388
KspI CCGCGG 1 cut(s) 348
Kzo9I GATC 2 cut(s) 366, 522
LmnI GCTCC 1 cut(s) 461
Lsp1109I GCAGC 5 cut(s) 83, 124, 232, 284, 466
LweI GCATC 2 cut(s) 253, 297
MaeI CTAG 1 cut(s) 204
MaeII ACGT 3 cut(s) 182, 281, 324
MaeIII GTNAC 4 cut(s) 77, 97, 118, 139
MalI GATC 2 cut(s) 368, 524
MboI GATC 2 cut(s) 366, 522
MluCI AATT 2 cut(s) 56, 447
MlyI GAGTC 2 cut(s) 141, 334
MnlI CCTC 1 cut(s) 386
Mph1103I ATGCAT 1 cut(s) 170
MspA1I CMGCKG 1 cut(s) 347
MspR9I CCNGG 1 cut(s) 492
MvnI CGCG 1 cut(s) 347
MwoI GCNNNNNNNGC 3 cut(s) 272, 476, 492
NciI CCSGG 1 cut(s) 492
NdeII GATC 2 cut(s) 366, 522
NlaIII CATG 3 cut(s) 168, 315, 388
NmuCI GTSAC 4 cut(s) 77, 97, 118, 139
NsiI ATGCAT 1 cut(s) 170
PcsI WCGNNNNNNNCGW 1 cut(s) 188
PfeI GAWTC 4 cut(s) 84, 105, 126, 188
PkrI GCNGC 8 cut(s) 70, 73, 93, 114, 135, 247, 274, 481
PleI GAGTC 2 cut(s) 141, 334
PpsI GAGTC 2 cut(s) 141, 334
Ppu21I YACGTR 1 cut(s) 282
PspEI GGTNACC 2 cut(s) 97, 139
RsaI GTAC 1 cut(s) 455
RsaNI GTAC 1 cut(s) 454
SacII CCGCGG 1 cut(s) 348
SatI GCNGC 8 cut(s) 69, 72, 92, 113, 134, 246, 273, 480
Sau3AI GATC 2 cut(s) 366, 522
SchI GAGTC 2 cut(s) 141, 334
ScrFI CCNGG 1 cut(s) 492
SetI ASST 9 cut(s) 178, 185, 219, 284, 294, 306, 327, 466, 513
SfaNI GCATC 2 cut(s) 253, 297
SfcI CTRYAG 1 cut(s) 358
Sfr303I CCGCGG 1 cut(s) 348
SgrBI CCGCGG 1 cut(s) 348
Sse9I AATT 2 cut(s) 56, 447
SsiI CCGC 9 cut(s) 68, 91, 110, 133, 285, 345, 347, 363, 406
SspMI CTAG 1 cut(s) 204
StyD4I CCNGG 1 cut(s) 490
TaaI ACNGT 3 cut(s) 252, 335, 425
TaiI ACGT 3 cut(s) 185, 284, 327
TaqI TCGA 1 cut(s) 191
TasI AATT 2 cut(s) 56, 447
TauI GCSGC 3 cut(s) 71, 94, 136
TfiI GAWTC 4 cut(s) 84, 105, 126, 188
TscAI CASTG 3 cut(s) 46, 123, 255
TseFI GTSAC 4 cut(s) 77, 97, 118, 139
TseI GCWGC 5 cut(s) 71, 112, 245, 272, 479
Tsp45I GTSAC 4 cut(s) 77, 97, 118, 139
TspGWI ACGGA 3 cut(s) 96, 229, 441
TspRI CASTG 3 cut(s) 46, 123, 255
XapI RAATTY 2 cut(s) 56, 447
XbaI TCTAGA 1 cut(s) 203
XspI CTAG 1 cut(s) 204
Zsp2I ATGCAT 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.