Rmu_sc0006070.1_g000003

lipid-transfer protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006070.1
Physical Location & Seq
Forward (+)
10394 .. 10696
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006070.1_g000003.1.cds

Sequence Viewer

Length: 303 bp
atgggtagtttcaataagctaatggcgatcctggtggtgacaatgcttgtgcttgtcgaagggtcaagagctttcagcttttgcaatgtgagtgaggatgctctaactgcttgcaagccgtcggtgacagagccgaacccatctgatccgactgcggagtgttgcaaggatctttccggggccgacttggattgcctttgcggttacaagacctcaccggtgttgcctgctctcggaatcagtccaaaacttgcgatgggacttccggctaagtgcggcctcacccctcctgccaattgctaa

Protein Analysis

100

Amino Acids

10.31

Weight (kDa)

4.81

Isoelectric Point (pI)

53.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 155, 201, 276
AclWI GGATC 3 cut(s) 22, 140, 177
AfiI CCNNNNNNNGG 1 cut(s) 233
AgeI ACCGGT 1 cut(s) 217
AgsI TTSAA 1 cut(s) 13
AjnI CCWGG 1 cut(s) 30
AluBI AGCT 3 cut(s) 19, 71, 78
AluI AGCT 3 cut(s) 19, 71, 78
AlwI GGATC 3 cut(s) 22, 140, 177
AoxI GGCC 2 cut(s) 180, 277
AsiGI ACCGGT 1 cut(s) 217
AspS9I GGNCC 1 cut(s) 180
AsuC2I CCSGG 1 cut(s) 178
AsuHPI GGTGA 4 cut(s) 49, 136, 207, 274
BccI CCATC 2 cut(s) 148, 250
BceAI ACGGC 1 cut(s) 103
BciT130I CCWGG 1 cut(s) 32
BcnI CCSGG 1 cut(s) 178
BisI GCNGC 1 cut(s) 277
BlsI GCNGC 1 cut(s) 278
Bme1390I CCNGG 2 cut(s) 32, 178
BmgT120I GGNCC 1 cut(s) 180
BmiI GGNNCC 1 cut(s) 181
BmrFI CCNGG 2 cut(s) 32, 178
BmsI GCATC 1 cut(s) 88
BpuMI CCSGG 1 cut(s) 178
BsaJI CCNNGG 1 cut(s) 177
BsaWI WCCGGW 1 cut(s) 217
Bsc4I CCNNNNNNNGG 1 cut(s) 233
Bse118I RCCGGY 1 cut(s) 217
Bse3DI GCAATG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 32
BseDI CCNNGG 1 cut(s) 177
BseGI GGATG 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 233
BseMI GCAATG 1 cut(s) 91
BshFI GGCC 2 cut(s) 182, 279
BshTI ACCGGT 1 cut(s) 217
BsiSI CCGG 3 cut(s) 177, 218, 266
BslFI GGGAC 1 cut(s) 273
BslI CCNNNNNNNGG 1 cut(s) 233
BsmFI GGGAC 1 cut(s) 273
BsnI GGCC 2 cut(s) 182, 279
Bsp143I GATC 3 cut(s) 27, 145, 169
BspACI CCGC 3 cut(s) 155, 201, 276
BspANI GGCC 2 cut(s) 182, 279
BspLI GGNNCC 1 cut(s) 181
BspPI GGATC 3 cut(s) 22, 140, 177
BsrDI GCAATG 1 cut(s) 91
BsrFI RCCGGY 1 cut(s) 217
BssAI RCCGGY 1 cut(s) 217
BssECI CCNNGG 1 cut(s) 177
BssMI GATC 3 cut(s) 27, 145, 169
Bst2UI CCWGG 1 cut(s) 32
BstC8I GCNNGC 3 cut(s) 112, 116, 228
BstDEI CTNAG 1 cut(s) 270
BstF5I GGATG 1 cut(s) 103
BstKTI GATC 3 cut(s) 30, 148, 172
BstMBI GATC 3 cut(s) 27, 145, 169
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 2 cut(s) 30, 176
BstX2I RGATCY 1 cut(s) 169
BstYI RGATCY 1 cut(s) 169
BsuRI GGCC 2 cut(s) 182, 279
BtgZI GCGATG 1 cut(s) 269
BtsCI GGATG 1 cut(s) 103
Cac8I GCNNGC 3 cut(s) 112, 116, 228
Cfr10I RCCGGY 1 cut(s) 217
Cfr13I GGNCC 1 cut(s) 180
CspAI ACCGGT 1 cut(s) 217
CviJI RGCY 8 cut(s) 19, 71, 78, 118, 133, 182, 269, 279
CviKI_1 RGCY 8 cut(s) 19, 71, 78, 118, 133, 182, 269, 279
DdeI CTNAG 1 cut(s) 270
DpnI GATC 3 cut(s) 29, 147, 171
DpnII GATC 3 cut(s) 27, 145, 169
EcoRII CCWGG 1 cut(s) 30
FaqI GGGAC 1 cut(s) 273
Fnu4HI GCNGC 1 cut(s) 277
FokI GGATG 1 cut(s) 110
Fsp4HI GCNGC 1 cut(s) 277
GluI GCNGC 1 cut(s) 277
HaeIII GGCC 2 cut(s) 182, 279
HapII CCGG 3 cut(s) 177, 218, 266
HinfI GANTC 1 cut(s) 237
HpaII CCGG 3 cut(s) 177, 218, 266
HphI GGTGA 4 cut(s) 49, 136, 207, 274
Hpy188I TCNGA 3 cut(s) 145, 150, 236
Hpy188III TCNNGA 1 cut(s) 66
Hpy99I CGWCG 1 cut(s) 124
HpyAV CCTTC 1 cut(s) 53
HpyCH4V TGCA 3 cut(s) 84, 114, 165
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
HpyF3I CTNAG 1 cut(s) 270
Kzo9I GATC 3 cut(s) 27, 145, 169
LpnPI CCDG 6 cut(s) 17, 44, 190, 231, 240, 279
LweI GCATC 1 cut(s) 88
MaeIII GTNAC 3 cut(s) 37, 124, 203
MalI GATC 3 cut(s) 29, 147, 171
MboI GATC 3 cut(s) 27, 145, 169
MfeI CAATTG 1 cut(s) 295
MflI RGATCY 1 cut(s) 169
MluCI AATT 1 cut(s) 295
MmeI TCCRAC 1 cut(s) 173
MnlI CCTC 4 cut(s) 88, 223, 290, 297
MspI CCGG 3 cut(s) 177, 218, 266
MspR9I CCNGG 2 cut(s) 32, 178
MunI CAATTG 1 cut(s) 295
MvaI CCWGG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 107
NciI CCSGG 1 cut(s) 178
NdeII GATC 3 cut(s) 27, 145, 169
NlaIV GGNNCC 1 cut(s) 181
NmuCI GTSAC 2 cut(s) 37, 124
PfeI GAWTC 1 cut(s) 237
PinAI ACCGGT 1 cut(s) 217
PkrI GCNGC 1 cut(s) 278
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
PspN4I GGNNCC 1 cut(s) 181
PspPI GGNCC 1 cut(s) 180
PsuI RGATCY 1 cut(s) 169
SatI GCNGC 1 cut(s) 277
Sau3AI GATC 3 cut(s) 27, 145, 169
Sau96I GGNCC 1 cut(s) 180
ScrFI CCNGG 2 cut(s) 32, 178
SetI ASST 4 cut(s) 21, 73, 80, 215
SfaNI GCATC 1 cut(s) 88
SgrAI CRCCGGYG 1 cut(s) 217
Sse9I AATT 1 cut(s) 295
SsiI CCGC 3 cut(s) 155, 201, 276
StyD4I CCNGG 2 cut(s) 30, 176
TaqI TCGA 1 cut(s) 57
TasI AATT 1 cut(s) 295
TauI GCSGC 1 cut(s) 279
TfiI GAWTC 1 cut(s) 237
TseFI GTSAC 2 cut(s) 37, 124
Tsp45I GTSAC 2 cut(s) 37, 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.