Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006582.1

Orthogroup ID

OG0006535

Physical Location & Seq

Genomic Coordinates Reverse (-)

22287 .. 24605

Gene Structure 2319 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006582.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1056 bp

atggagttttcaagtagtaaactcttgggttccttgagcttacttgctctagttttcacagtcgttcttggagaccctttagttccagctcttatcatatttggggactctgtagtcgatgtgggaaacaataacaatctcaacacagtcatcaaggccaactttcctccttacggaagagactttgtgaatcacaaaccaactggaagattctgtaatggaaagcttgccaccgatttcactgctgaatatctgggattcacttcatatccaccagcgtacctaagccaagaagccagcgggaagaacctcttgactggagtcaactttgcctcagctgcttctggattttatgacccaacagcccagttatataattcgatttcactgacccagcaactgaataactataaggagtatcaaagtaaagtggtgaatctggtaggacaaactaaagccaatgccatattctctggaggcatccaccttctaagtgcagggagcagtgatttcattcagaactactacgtcactccccttgttacggtctatacgcccgatcaattctcggacattctcattagatcctactctacattcattcagaatttgtatgggttgggagcaagaaggattggagtcacaagcttaccgccaacagggtgtttgccagcagcaatcaccctatttggcaatggaaacaaccaatgcgtcacaagactaaacggagatgccatttcattcaacaagaagctaaagagcacatctcaaagtttgcagaccaaacttccgggcctcaagcttgtggtcttcgatatcttccagcctctgctggatatggtcacaaagcctagtgataatgggttcatggagtcgagacgagcttgctgtggaacaggaacattagaaacctctgtgctttgcaactcggggtctataggaacatgtagcaatgtgactggttatgtgttttgggatggattccatccctctcaagctgccaacgaggtcttggccggtgatctacttcagcagggtttcgatcttatatcctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Lipase_GDSL

Protein Analysis

351

Amino Acids

37.73

Weight (kDa)

6.29

Isoelectric Point (pI)

26.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006535)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G53100 AT5G03810 AT5G03820 AT5G03820
fragaria_vesca	FvH4_6g17360 FvH4_6g17360 FvH4_6g17360
prunus_persica	Prupe.7G121900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr3g0471511 RchiOBHm_Chr3g0471521
rosa_laevigata	RLG00000024157 RLG00000024170 RLG00000024172
rosa_multiflora	Rmu_sc0006582.1_g000003 Rmu_sc0030769.1_g000002 Rmu_ssc0000445.1_g000001
rosa_roxburghii	Rroxscaffold_6G00409830 Rroxscaffold_6G00409890
rosa_rugosa	Rorug03G0118200
rosa_samantha	Rh3AG168300 Rh3BG193900 Rh3CG184300 Rh3DG181600 Rh3DG181800
rosa_wichuraiana	Rw3G015850 Rw3G015870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	113
AciI	CCGC	2 cut(s)	300, 653
AclWI	GGATC	1 cut(s)	579
AcoI	YGGCCR	1 cut(s)	1014
AcsI	RAATTY	1 cut(s)	607
AcuI	CTGAAG	1 cut(s)	1013
AfaI	GTAC	1 cut(s)	281
AfiI	CCNNNNNNNGG	3 cut(s)	173, 544, 659
AflIII	ACRYGT	1 cut(s)	944
AgsI	TTSAA	2 cut(s)	12, 745
AjuI	GAANNNNNNNTTGG	2 cut(s)	452, 484
AluBI	AGCT	9 cut(s)	39, 89, 226, 338, 648, 754, 802, 884, 998
AluI	AGCT	9 cut(s)	39, 89, 226, 338, 648, 754, 802, 884, 998
Alw21I	GWGCWC	1 cut(s)	764
Alw26I	GTCTC	3 cut(s)	66, 174, 871
AlwI	GGATC	1 cut(s)	579
AlwNI	CAGNNNCTG	2 cut(s)	400, 829
Ama87I	CYCGRG	1 cut(s)	928
AoxI	GGCC	3 cut(s)	156, 793, 1014
ApeKI	GCWGC	3 cut(s)	338, 674, 998
ApoI	RAATTY	1 cut(s)	607
AspS9I	GGNCC	1 cut(s)	793
AsuC2I	CCSGG	1 cut(s)	792
AsuHPI	GGTGA	3 cut(s)	445, 673, 1031
AvaI	CYCGRG	1 cut(s)	928
BaeI	ACNNNNGTAYC	2 cut(s)	263, 296
BbsI	GAAGAC	1 cut(s)	802
Bbv12I	GWGCWC	1 cut(s)	764
BbvCI	CCTCAGC	1 cut(s)	334
BbvI	GCAGC	3 cut(s)	325, 686, 985
BccI	CCATC	2 cut(s)	971, 993
BcgI	CGANNNNNNTGC	2 cut(s)	224, 258
BcnI	CCSGG	1 cut(s)	792
BcoDI	GTCTC	3 cut(s)	66, 174, 871
BfaI	CTAG	2 cut(s)	50, 852
BfmI	CTRYAG	2 cut(s)	111, 936
BisI	GCNGC	3 cut(s)	339, 675, 999
BlsI	GCNGC	3 cut(s)	340, 676, 1000
Bme1390I	CCNGG	1 cut(s)	792
BmeT110I	CYCGRG	1 cut(s)	928
BmgT120I	GGNCC	1 cut(s)	793
BmiI	GGNNCC	1 cut(s)	31
BmrFI	CCNGG	1 cut(s)	792
BmrI	ACTGGG	1 cut(s)	361
BmsI	GCATC	2 cut(s)	489, 721
BmuI	ACTGGG	1 cut(s)	361
BoxI	GACNNNNGTC	1 cut(s)	320
BpiI	GAAGAC	1 cut(s)	802
BplI	GAGNNNNNCTC	2 cut(s)	751, 783
BpmI	CTGGAG	2 cut(s)	339, 495
Bpu10I	CCTNAGC	2 cut(s)	284, 334
BpuEI	CTTGAG	3 cut(s)	55, 782, 978
BpuMI	CCSGG	1 cut(s)	792
BsaI	GGTCTC	1 cut(s)	66
Bsc4I	CCNNNNNNNGG	3 cut(s)	173, 544, 659
Bse118I	RCCGGY	1 cut(s)	1016
Bse1I	ACTGG	4 cut(s)	208, 322, 367, 964
Bse3DI	GCAATG	2 cut(s)	700, 958
BseGI	GGATG	3 cut(s)	480, 982, 985
BseLI	CCNNNNNNNGG	3 cut(s)	173, 544, 659
BseMI	GCAATG	2 cut(s)	700, 958
BseMII	CTCAG	1 cut(s)	348
BseNI	ACTGG	4 cut(s)	208, 322, 367, 964
BseXI	GCAGC	3 cut(s)	325, 686, 985
BseYI	CCCAGC	1 cut(s)	393
BsgI	GTGCAG	1 cut(s)	516
BshFI	GGCC	3 cut(s)	158, 795, 1016
BsiHKAI	GWGCWC	1 cut(s)	764
BsiHKCI	CYCGRG	1 cut(s)	928
BsiSI	CCGG	2 cut(s)	791, 1017
BslFI	GGGAC	1 cut(s)	119
BslI	CCNNNNNNNGG	3 cut(s)	173, 544, 659
BsmAI	GTCTC	3 cut(s)	66, 174, 871
BsmBI	CGTCTC	1 cut(s)	871
BsmFI	GGGAC	1 cut(s)	119
BsnI	GGCC	3 cut(s)	158, 795, 1016
Bso31I	GGTCTC	1 cut(s)	66
BsoBI	CYCGRG	1 cut(s)	928
Bsp1286I	GDGCHC	1 cut(s)	764
Bsp143I	GATC	4 cut(s)	559, 584, 1021, 1042
BspACI	CCGC	2 cut(s)	300, 653
BspANI	GGCC	3 cut(s)	158, 795, 1016
BspCNI	CTCAG	1 cut(s)	347
BspLI	GGNNCC	1 cut(s)	31
BspPI	GGATC	1 cut(s)	579
BspTNI	GGTCTC	1 cut(s)	66
BsrDI	GCAATG	2 cut(s)	700, 958
BsrFI	RCCGGY	1 cut(s)	1016
BsrI	ACTGG	4 cut(s)	208, 322, 367, 964
BssAI	RCCGGY	1 cut(s)	1016
BssMI	GATC	4 cut(s)	559, 584, 1021, 1042
Bst4CI	ACNGT	3 cut(s)	61, 148, 547
Bst6I	CTCTTC	1 cut(s)	172
BstC8I	GCNNGC	4 cut(s)	228, 298, 672, 886
BstDEI	CTNAG	3 cut(s)	284, 334, 491
BstF5I	GGATG	3 cut(s)	480, 982, 985
BstKTI	GATC	4 cut(s)	562, 587, 1024, 1045
BstMAI	GTCTC	3 cut(s)	66, 174, 871
BstMBI	GATC	4 cut(s)	559, 584, 1021, 1042
BstMWI	GCNNNNNNNGC	1 cut(s)	338
BstNSI	RCATGY	1 cut(s)	948
BstPAI	GACNNNNGTC	1 cut(s)	320
BstSCI	CCNGG	1 cut(s)	790
BstSFI	CTRYAG	2 cut(s)	111, 936
BstV1I	GCAGC	3 cut(s)	325, 686, 985
BstV2I	GAAGAC	1 cut(s)	802
BstX2I	RGATCY	1 cut(s)	584
BstYI	RGATCY	1 cut(s)	584
BsuRI	GGCC	3 cut(s)	158, 795, 1016
BtsCI	GGATG	3 cut(s)	480, 982, 985
BtsI	GCAGTG	2 cut(s)	240, 511
BtsIMutI	CAGTG	3 cut(s)	240, 386, 511
Cac8I	GCNNGC	4 cut(s)	228, 298, 672, 886
CaiI	CAGNNNCTG	2 cut(s)	400, 829
Cfr10I	RCCGGY	1 cut(s)	1016
Cfr13I	GGNCC	1 cut(s)	793
CseI	GACGC	1 cut(s)	700
Csp6I	GTAC	1 cut(s)	280
CviAII	CATG	2 cut(s)	868, 945
CviQI	GTAC	1 cut(s)	280
DdeI	CTNAG	3 cut(s)	284, 334, 491
DpnI	GATC	4 cut(s)	561, 586, 1023, 1044
DpnII	GATC	4 cut(s)	559, 584, 1021, 1042
DrdI	GACNNNNNNGTC	1 cut(s)	113
DseDI	GACNNNNNNGTC	1 cut(s)	113
EaeI	YGGCCR	1 cut(s)	1014
Eam1104I	CTCTTC	1 cut(s)	172
EarI	CTCTTC	1 cut(s)	172
Eco31I	GGTCTC	1 cut(s)	66
Eco32I	GATATC	1 cut(s)	817
Eco57I	CTGAAG	1 cut(s)	1013
Eco88I	CYCGRG	1 cut(s)	928
EcoRV	GATATC	1 cut(s)	817
Esp3I	CGTCTC	1 cut(s)	871
FaeI	CATG	2 cut(s)	871, 948
FalI	AAGNNNNNCTT	4 cut(s)	146, 178, 296, 328
FaqI	GGGAC	1 cut(s)	119
FatI	CATG	2 cut(s)	867, 944
FauI	CCCGC	1 cut(s)	293
Fnu4HI	GCNGC	3 cut(s)	339, 675, 999
FokI	GGATG	3 cut(s)	467, 972, 989
Fsp4HI	GCNGC	3 cut(s)	339, 675, 999
FspBI	CTAG	2 cut(s)	50, 852
GluI	GCNGC	3 cut(s)	339, 675, 999
GsaI	CCCAGC	1 cut(s)	397
GsuI	CTGGAG	2 cut(s)	339, 495
HaeIII	GGCC	3 cut(s)	158, 795, 1016
HapII	CCGG	2 cut(s)	791, 1017
HgaI	GACGC	1 cut(s)	700
Hin1II	CATG	2 cut(s)	871, 948
HincII	GTYRAC	1 cut(s)	325
HindII	GTYRAC	1 cut(s)	325
HindIII	AAGCTT	3 cut(s)	224, 646, 800
HinfI	GANTC	9 cut(s)	107, 190, 210, 258, 321, 436, 639, 872, 981
HpaII	CCGG	2 cut(s)	791, 1017
HphI	GGTGA	3 cut(s)	445, 673, 1031
Hpy166II	GTNNAC	2 cut(s)	20, 325
Hpy188I	TCNGA	3 cut(s)	519, 571, 606
Hpy188III	TCNNGA	5 cut(s)	313, 345, 474, 876, 1053
Hpy8I	GTNNAC	2 cut(s)	20, 325
HpyAV	CCTTC	2 cut(s)	497, 624
HpyCH4III	ACNGT	3 cut(s)	61, 148, 547
HpyCH4IV	ACGT	1 cut(s)	528
HpyCH4V	TGCA	3 cut(s)	497, 778, 924
HpyF10VI	GCNNNNNNNGC	1 cut(s)	338
HpyF3I	CTNAG	3 cut(s)	284, 334, 491
HpySE526I	ACGT	1 cut(s)	528
Hsp92II	CATG	2 cut(s)	871, 948
Kzo9I	GATC	4 cut(s)	559, 584, 1021, 1042
LmnI	GCTCC	2 cut(s)	501, 623
Lsp1109I	GCAGC	3 cut(s)	325, 686, 985
LweI	GCATC	2 cut(s)	489, 721
MaeI	CTAG	2 cut(s)	50, 852
MaeII	ACGT	1 cut(s)	528
MaeIII	GTNAC	6 cut(s)	529, 541, 640, 712, 841, 955
MalI	GATC	4 cut(s)	561, 586, 1023, 1044
MboI	GATC	4 cut(s)	559, 584, 1021, 1042
MboII	GAAGA	5 cut(s)	189, 219, 316, 802, 811
MflI	RGATCY	1 cut(s)	584
MhlI	GDGCHC	1 cut(s)	764
MluCI	AATT	3 cut(s)	376, 563, 607
MlyI	GAGTC	4 cut(s)	101, 330, 648, 881
MnlI	CCTC	9 cut(s)	177, 320, 343, 470, 806, 837, 922, 1000, 1000
MspA1I	CMGCKG	2 cut(s)	300, 338
MspI	CCGG	2 cut(s)	791, 1017
MspR9I	CCNGG	1 cut(s)	792
MwoI	GCNNNNNNNGC	1 cut(s)	338
NciI	CCSGG	1 cut(s)	792
NdeII	GATC	4 cut(s)	559, 584, 1021, 1042
NlaIII	CATG	2 cut(s)	871, 948
NlaIV	GGNNCC	1 cut(s)	31
NmuCI	GTSAC	5 cut(s)	529, 640, 712, 841, 955
NspI	RCATGY	1 cut(s)	948
PciI	ACATGT	1 cut(s)	944
PfeI	GAWTC	5 cut(s)	190, 210, 258, 436, 981
PkrI	GCNGC	3 cut(s)	340, 676, 1000
PleI	GAGTC	4 cut(s)	101, 329, 647, 880
PpsI	GAGTC	4 cut(s)	101, 329, 647, 880
PscI	ACATGT	1 cut(s)	944
PshAI	GACNNNNGTC	1 cut(s)	320
PspFI	CCCAGC	1 cut(s)	393
PspN4I	GGNNCC	1 cut(s)	31
PspPI	GGNCC	1 cut(s)	793
PstNI	CAGNNNCTG	2 cut(s)	400, 829
PsuI	RGATCY	1 cut(s)	584
PvuII	CAGCTG	1 cut(s)	338
RsaI	GTAC	1 cut(s)	281
RsaNI	GTAC	1 cut(s)	280
SatI	GCNGC	3 cut(s)	339, 675, 999
Sau3AI	GATC	4 cut(s)	559, 584, 1021, 1042
Sau96I	GGNCC	1 cut(s)	793
SchI	GAGTC	4 cut(s)	101, 330, 648, 881
ScrFI	CCNGG	1 cut(s)	792
SduI	GDGCHC	1 cut(s)	764
SfaNI	GCATC	2 cut(s)	489, 721
SfcI	CTRYAG	2 cut(s)	111, 936
SmlI	CTYRAG	3 cut(s)	34, 797, 993
SmoI	CTYRAG	3 cut(s)	34, 797, 993
Sse9I	AATT	3 cut(s)	376, 563, 607
SsiI	CCGC	2 cut(s)	300, 653
SspMI	CTAG	2 cut(s)	50, 852
StyD4I	CCNGG	1 cut(s)	790
TaaI	ACNGT	3 cut(s)	61, 148, 547
TaiI	ACGT	1 cut(s)	531
TaqI	TCGA	5 cut(s)	117, 380, 813, 875, 1041
TasI	AATT	3 cut(s)	376, 563, 607
TfiI	GAWTC	5 cut(s)	190, 210, 258, 436, 981
TscAI	CASTG	3 cut(s)	247, 393, 511
TseFI	GTSAC	5 cut(s)	529, 640, 712, 841, 955
TseI	GCWGC	3 cut(s)	338, 674, 998
Tsp45I	GTSAC	5 cut(s)	529, 640, 712, 841, 955
TspDTI	ATGAA	5 cut(s)	255, 502, 589, 729, 856
TspGWI	ACGGA	2 cut(s)	189, 741
TspRI	CASTG	3 cut(s)	247, 393, 511
XapI	RAATTY	1 cut(s)	607
XceI	RCATGY	1 cut(s)	948
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1009
XspI	CTAG	2 cut(s)	50, 852

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.