Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006792.1

Orthogroup ID

OG0007058

Physical Location & Seq

Genomic Coordinates Reverse (-)

88285 .. 92678

Gene Structure 4394 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006792.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1311 bp

atggcctacgagctctcggatagcagtggaacggatgatgaccttcccccatctcatcaaaaccgctttcaaagaggaggccgaagttctgggaatggaagatctgcagctgttggttctgctccattacctaggatgcatggtgatatggaaacacagatccaccacattgagcaagaagcatactgttcagtcctgcgggcatttaaagcccaatctgatgccatcacctgggtaggtgtttgtttgatcatggagtggagaaaaaccagtgggcctcagctgggtacacataatgccgctcagcctgttcatgaccccatacctagtccaactgtttcggcatcacgtaagaaacagaaaacatcacagtctgtagcttctttatcacatggtggtgctccatctccagtgctgcctccatccatgcaaccttcctcatcagccttgagacgtggtcctcctccaggagctcggagcaagaagtcaaaatcatccacacagttcccttctacaagtattaccggaaggccccaagccccaaaccgaggttcttcaggtggctttgtggcaactgagcctgctgaggcaacaacttatgatccattaataggaagaaaagtatggacaaggtggcctgcggacaaccatttctatgaggctgtaataactgattacaaccatattcagggccgacatgctctggtttatgatatcaatacagcggatgaaacatgggaatgggtcaacctaaaagagatatctcctgaagatattcggtgggaaggtgatgatcctgggttttctcgtaggggtggtcgacctggatctggccgagggactaagaagtccatgggacgtggtggtgcagtttcaggtgcaggaaggggtagagggaccacaaaaggtcagcctaagaaggatttgcccccacaacaaaatggcattggcaggaaggccatgagcgacattgaaatacttcatacagactcgttgattaaagaggtggaaaaggtcttcagtgctagccatcctgacccgatggagattgagaaagctaagaaagttctcaaagagcatgaacaggcattgatcgatgcaattgcaacgcttgaagatgcatcagatggtgaaagtgatgaacatacattctctcaaagacaaccaatggaccaagaacgaggatggagaaaacggcaatatgatgaaatggcagaaggtcaggcagttgatggttcaaatggtactaaaatcatgagagatggtagaattgcatctgatgaccaacgttttgaaggcgatggcatatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ENT LBR_tudor

Protein Analysis

436

Amino Acids

47.46

Weight (kDa)

6.94

Isoelectric Point (pI)

51.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007058)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G13020 AT5G13020 AT5G13020
fragaria_vesca	FvH4_3g44080 FvH4_3g44080
malus_domestica	MD03G1018600.v1.1 MD11G1019600.v1.1 MD11G1020100.v1.1
prunus_persica	Prupe.6G017900_v2.0.a1 Prupe.6G017900_v2.0.a1 Prupe.6G017900_v2.0.a1
pyrus_communis	pycom03g01610 pycom11g01450
rosa_chinensis	RchiOBHm_Chr5g0080381
rosa_laevigata	RLG00000036850
rosa_multiflora	Rmu_sc0000826.1_g000013 Rmu_sc0006792.1_g000024
rosa_roxburghii	Rroxscaffold_1G00003020
rosa_rugosa	Rorug05G0468200
rosa_samantha	Rh5AG522500 Rh5BG544000 Rh5CG567600 Rh5DG554300
rosa_wichuraiana	Rw0G023260 Rw5G048560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	847
AccB7I	CCANNNNNTGG	1 cut(s)	231
AccBSI	CCGCTC	1 cut(s)	302
AccI	GTMKAC	1 cut(s)	820
AciI	CCGC	5 cut(s)	64, 199, 300, 641, 725
AclI	AACGTT	1 cut(s)	1288
AclWI	GGATC	4 cut(s)	154, 596, 788, 835
AcoI	YGGCCR	1 cut(s)	832
AcuI	CTGAAG	3 cut(s)	540, 789, 1003
AdeI	CACNNNGTG	1 cut(s)	395
AfaI	GTAC	2 cut(s)	289, 1246
AfiI	CCNNNNNNNGG	7 cut(s)	231, 284, 467, 548, 611, 688, 830
AgsI	TTSAA	5 cut(s)	71, 974, 1115, 1239, 1295
AjiI	CACGTC	2 cut(s)	455, 860
AjnI	CCWGG	4 cut(s)	230, 466, 796, 823
AjuI	GAANNNNNNNTTGG	2 cut(s)	535, 567
AluBI	AGCT	6 cut(s)	13, 110, 283, 380, 473, 1058
AluI	AGCT	6 cut(s)	13, 110, 283, 380, 473, 1058
Alw21I	GWGCWC	3 cut(s)	15, 403, 475
Alw26I	GTCTC	1 cut(s)	445
AlwI	GGATC	4 cut(s)	154, 596, 788, 835
AoxI	GGCC	8 cut(s)	3, 79, 275, 530, 635, 691, 832, 957
ApeKI	GCWGC	2 cut(s)	107, 415
ArsI	GACNNNNNNTTYG	2 cut(s)	1274, 1306
AseI	ATTAAT	1 cut(s)	608
Asp700I	GAANNNNTTC	2 cut(s)	774, 978
AspA2I	CCTAGG	1 cut(s)	131
AspS9I	GGNCC	6 cut(s)	275, 458, 531, 691, 897, 1171
AsuHPI	GGTGA	4 cut(s)	155, 220, 800, 1142
AsuNHI	GCTAGC	1 cut(s)	1025
AvaII	GGWCC	3 cut(s)	458, 897, 1171
AvrII	CCTAGG	1 cut(s)	131
BanII	GRGCYC	2 cut(s)	15, 475
BbsI	GAAGAC	1 cut(s)	1009
Bbv12I	GWGCWC	3 cut(s)	15, 403, 475
BbvCI	CCTCAGC	2 cut(s)	279, 585
BbvI	GCAGC	2 cut(s)	119, 402
BceAI	ACGGC	1 cut(s)	1211
BcgI	CGANNNNNNTGC	2 cut(s)	1085, 1119
BciT130I	CCWGG	4 cut(s)	232, 468, 798, 825
BclI	TGATCA	1 cut(s)	249
BcoDI	GTCTC	1 cut(s)	445
BfaI	CTAG	3 cut(s)	132, 327, 1026
BfmI	CTRYAG	2 cut(s)	105, 375
BglII	AGATCT	1 cut(s)	101
BisI	GCNGC	3 cut(s)	108, 300, 416
BlnI	CCTAGG	1 cut(s)	131
BlpI	GCTNAGC	1 cut(s)	303
BlsI	GCNGC	3 cut(s)	109, 301, 417
Bme1390I	CCNGG	4 cut(s)	232, 468, 798, 825
Bme18I	GGWCC	3 cut(s)	458, 897, 1171
BmgBI	CACGTC	2 cut(s)	455, 860
BmgT120I	GGNCC	6 cut(s)	275, 458, 531, 691, 897, 1171
BmiI	GGNNCC	2 cut(s)	533, 898
BmrFI	CCNGG	4 cut(s)	232, 468, 798, 825
BmsI	GCATC	7 cut(s)	126, 211, 353, 1087, 1108, 1130, 1283
BmtI	GCTAGC	1 cut(s)	1029
BpiI	GAAGAC	1 cut(s)	1009
BpmI	CTGGAG	2 cut(s)	393, 450
Bpu10I	CCTNAGC	2 cut(s)	279, 585
Bpu1102I	GCTNAGC	1 cut(s)	303
BpuEI	CTTGAG	1 cut(s)	469
Bsa29I	ATCGAT	1 cut(s)	1095
BsaAI	YACGTR	1 cut(s)	350
BsaJI	CCNNGG	6 cut(s)	131, 231, 547, 797, 835, 852
BsaWI	WCCGGW	1 cut(s)	524
Bsc4I	CCNNNNNNNGG	7 cut(s)	231, 284, 467, 548, 611, 688, 830
Bse1I	ACTGG	2 cut(s)	270, 410
BseBI	CCWGG	4 cut(s)	232, 468, 798, 825
BseCI	ATCGAT	1 cut(s)	1095
BseDI	CCNNGG	6 cut(s)	131, 231, 547, 797, 835, 852
BseGI	GGATG	7 cut(s)	40, 141, 422, 494, 733, 1030, 1190
BseLI	CCNNNNNNNGG	7 cut(s)	231, 284, 467, 548, 611, 688, 830
BseMII	CTCAG	4 cut(s)	293, 317, 567, 576
BseNI	ACTGG	2 cut(s)	270, 410
BseRI	GAGGAG	2 cut(s)	90, 453
BseXI	GCAGC	2 cut(s)	119, 402
BseYI	CCCAGC	1 cut(s)	283
BsgI	GTGCAG	2 cut(s)	888, 900
BshFI	GGCC	8 cut(s)	5, 81, 277, 532, 637, 693, 834, 959
BshVI	ATCGAT	1 cut(s)	1095
BsiHKAI	GWGCWC	3 cut(s)	15, 403, 475
BsiSI	CCGG	1 cut(s)	525
BslFI	GGGAC	3 cut(s)	853, 870, 910
BslI	CCNNNNNNNGG	7 cut(s)	231, 284, 467, 548, 611, 688, 830
BsmAI	GTCTC	1 cut(s)	445
BsmBI	CGTCTC	1 cut(s)	445
BsmFI	GGGAC	3 cut(s)	853, 870, 910
BsnI	GGCC	8 cut(s)	5, 81, 277, 532, 637, 693, 834, 959
Bsp1286I	GDGCHC	3 cut(s)	15, 403, 475
Bsp143I	GATC	7 cut(s)	101, 159, 249, 601, 793, 827, 1092
Bsp1720I	GCTNAGC	1 cut(s)	303
Bsp19I	CCATGG	1 cut(s)	852
BspACI	CCGC	5 cut(s)	64, 199, 300, 641, 725
BspANI	GGCC	8 cut(s)	5, 81, 277, 532, 637, 693, 834, 959
BspCNI	CTCAG	4 cut(s)	292, 316, 568, 577
BspDI	ATCGAT	1 cut(s)	1095
BspHI	TCATGA	2 cut(s)	313, 1254
BspLI	GGNNCC	2 cut(s)	533, 898
BspMAI	CTGCAG	1 cut(s)	109
BspOI	GCTAGC	1 cut(s)	1029
BspPI	GGATC	4 cut(s)	154, 596, 788, 835
BsrBI	CCGCTC	1 cut(s)	302
BsrI	ACTGG	2 cut(s)	270, 410
BssECI	CCNNGG	6 cut(s)	131, 231, 547, 797, 835, 852
BssMI	GATC	7 cut(s)	101, 159, 249, 601, 793, 827, 1092
BssT1I	CCWWGG	2 cut(s)	131, 852
Bst2UI	CCWGG	4 cut(s)	232, 468, 798, 825
Bst4CI	ACNGT	4 cut(s)	188, 337, 372, 504
BstBAI	YACGTR	1 cut(s)	350
BstC8I	GCNNGC	4 cut(s)	201, 582, 639, 1027
BstDEI	CTNAG	7 cut(s)	279, 303, 576, 585, 843, 915, 1059
BstDSI	CCRYGG	1 cut(s)	852
BstENI	CCTNNNNNAGG	1 cut(s)	465
BstF5I	GGATG	7 cut(s)	40, 141, 422, 494, 733, 1030, 1190
BstKTI	GATC	7 cut(s)	104, 162, 252, 604, 796, 830, 1095
BstMAI	GTCTC	1 cut(s)	445
BstMBI	GATC	7 cut(s)	101, 159, 249, 601, 793, 827, 1092
BstMWI	GCNNNNNNNGC	1 cut(s)	209
BstNI	CCWGG	4 cut(s)	232, 468, 798, 825
BstNSI	RCATGY	1 cut(s)	701
BstSCI	CCNGG	4 cut(s)	230, 466, 796, 823
BstSFI	CTRYAG	2 cut(s)	105, 375
BstV1I	GCAGC	2 cut(s)	119, 402
BstV2I	GAAGAC	1 cut(s)	1009
BstX2I	RGATCY	3 cut(s)	101, 159, 827
BstYI	RGATCY	3 cut(s)	101, 159, 827
Bsu15I	ATCGAT	1 cut(s)	1095
BsuRI	GGCC	8 cut(s)	5, 81, 277, 532, 637, 693, 834, 959
BsuTUI	ATCGAT	1 cut(s)	1095
BtgI	CCRYGG	1 cut(s)	852
BtrI	CACGTC	2 cut(s)	455, 860
BtsCI	GGATG	7 cut(s)	40, 141, 422, 494, 733, 1030, 1190
BtsI	GCAGTG	1 cut(s)	31
BtsIMutI	CAGTG	4 cut(s)	31, 277, 417, 1027
Cac8I	GCNNGC	4 cut(s)	201, 582, 639, 1027
CciI	TCATGA	2 cut(s)	313, 1254
Cfr13I	GGNCC	6 cut(s)	275, 458, 531, 691, 897, 1171
ClaI	ATCGAT	1 cut(s)	1095
Csp6I	GTAC	2 cut(s)	288, 1245
CviQI	GTAC	2 cut(s)	288, 1245
DdeI	CTNAG	7 cut(s)	279, 303, 576, 585, 843, 915, 1059
DpnI	GATC	7 cut(s)	103, 161, 251, 603, 795, 829, 1094
DpnII	GATC	7 cut(s)	101, 159, 249, 601, 793, 827, 1092
DraI	TTTAAA	1 cut(s)	208
DraIII	CACNNNGTG	1 cut(s)	395
DrdI	GACNNNNNNGTC	1 cut(s)	847
DseDI	GACNNNNNNGTC	1 cut(s)	847
EaeI	YGGCCR	1 cut(s)	832
Ecl136II	GAGCTC	2 cut(s)	13, 473
Eco130I	CCWWGG	2 cut(s)	131, 852
Eco24I	GRGCYC	2 cut(s)	15, 475
Eco32I	GATATC	2 cut(s)	715, 762
Eco47I	GGWCC	3 cut(s)	458, 897, 1171
Eco53kI	GAGCTC	2 cut(s)	13, 473
Eco57I	CTGAAG	3 cut(s)	540, 789, 1003
EcoICRI	GAGCTC	2 cut(s)	13, 473
EcoNI	CCTNNNNNAGG	1 cut(s)	465
EcoO109I	RGGNCCY	1 cut(s)	531
EcoRII	CCWGG	4 cut(s)	230, 466, 796, 823
EcoRV	GATATC	2 cut(s)	715, 762
EcoT14I	CCWWGG	2 cut(s)	131, 852
EcoT22I	ATGCAT	2 cut(s)	141, 1123
EcoT38I	GRGCYC	2 cut(s)	15, 475
ErhI	CCWWGG	2 cut(s)	131, 852
Esp3I	CGTCTC	1 cut(s)	445
FaqI	GGGAC	3 cut(s)	853, 870, 910
FauI	CCCGC	1 cut(s)	192
FauNDI	CATATG	1 cut(s)	1307
FbaI	TGATCA	1 cut(s)	249
FblI	GTMKAC	1 cut(s)	820
Fnu4HI	GCNGC	3 cut(s)	108, 300, 416
FokI	GGATG	7 cut(s)	47, 148, 409, 481, 740, 1017, 1197
FriOI	GRGCYC	2 cut(s)	15, 475
Fsp4HI	GCNGC	3 cut(s)	108, 300, 416
FspBI	CTAG	3 cut(s)	132, 327, 1026
GluI	GCNGC	3 cut(s)	108, 300, 416
GsaI	CCCAGC	1 cut(s)	287
GsuI	CTGGAG	2 cut(s)	393, 450
HaeIII	GGCC	8 cut(s)	5, 81, 277, 532, 637, 693, 834, 959
HapII	CCGG	1 cut(s)	525
HincII	GTYRAC	2 cut(s)	748, 821
HindII	GTYRAC	2 cut(s)	748, 821
HinfI	GANTC	1 cut(s)	989
HpaII	CCGG	1 cut(s)	525
HphI	GGTGA	4 cut(s)	155, 220, 800, 1142
Hpy166II	GTNNAC	3 cut(s)	290, 748, 821
Hpy188I	TCNGA	5 cut(s)	19, 220, 477, 1126, 1279
Hpy188III	TCNNGA	4 cut(s)	314, 767, 1034, 1255
Hpy8I	GTNNAC	3 cut(s)	290, 748, 821
HpyCH4III	ACNGT	4 cut(s)	188, 337, 372, 504
HpyCH4IV	ACGT	4 cut(s)	349, 454, 859, 1288
HpyCH4V	TGCA	9 cut(s)	107, 139, 430, 869, 881, 1100, 1106, 1121, 1274
HpyF10VI	GCNNNNNNNGC	1 cut(s)	209
HpyF3I	CTNAG	7 cut(s)	279, 303, 576, 585, 843, 915, 1059
HpySE526I	ACGT	4 cut(s)	349, 454, 859, 1288
Ksp22I	TGATCA	1 cut(s)	249
Kzo9I	GATC	7 cut(s)	101, 159, 249, 601, 793, 827, 1092
LmnI	GCTCC	4 cut(s)	127, 406, 470, 477
Lsp1109I	GCAGC	2 cut(s)	119, 402
LweI	GCATC	7 cut(s)	126, 211, 353, 1087, 1108, 1130, 1283
MaeI	CTAG	3 cut(s)	132, 327, 1026
MaeII	ACGT	4 cut(s)	349, 454, 859, 1288
MalI	GATC	7 cut(s)	103, 161, 251, 603, 795, 829, 1094
MbiI	CCGCTC	1 cut(s)	302
MboI	GATC	7 cut(s)	101, 159, 249, 601, 793, 827, 1092
MboII	GAAGA	6 cut(s)	111, 546, 627, 782, 1009, 1127
MfeI	CAATTG	1 cut(s)	1101
MflI	RGATCY	3 cut(s)	101, 159, 827
MhlI	GDGCHC	3 cut(s)	15, 403, 475
MluCI	AATT	2 cut(s)	1101, 1269
MlyI	GAGTC	1 cut(s)	983
MmeI	TCCRAC	1 cut(s)	356
Mph1103I	ATGCAT	2 cut(s)	141, 1123
MroXI	GAANNNNTTC	2 cut(s)	774, 978
MseI	TTAA	3 cut(s)	207, 608, 999
MslI	CAYNNNNRTG	3 cut(s)	396, 654, 739
MspA1I	CMGCKG	3 cut(s)	110, 283, 725
MspI	CCGG	1 cut(s)	525
MspR9I	CCNGG	4 cut(s)	232, 468, 798, 825
MunI	CAATTG	1 cut(s)	1101
MvaI	CCWGG	4 cut(s)	232, 468, 798, 825
MwoI	GCNNNNNNNGC	1 cut(s)	209
NcoI	CCATGG	1 cut(s)	852
NdeI	CATATG	1 cut(s)	1307
NdeII	GATC	7 cut(s)	101, 159, 249, 601, 793, 827, 1092
NheI	GCTAGC	1 cut(s)	1025
NlaIV	GGNNCC	2 cut(s)	533, 898
NmeAIII	GCCGAG	1 cut(s)	860
NsiI	ATGCAT	2 cut(s)	141, 1123
NspI	RCATGY	1 cut(s)	701
PagI	TCATGA	2 cut(s)	313, 1254
PdmI	GAANNNNTTC	2 cut(s)	774, 978
PflFI	GACNNNGTC	1 cut(s)	456
PflMI	CCANNNNNTGG	1 cut(s)	231
PfoI	TCCNGGA	1 cut(s)	466
PkrI	GCNGC	3 cut(s)	109, 301, 417
PleI	GAGTC	1 cut(s)	983
PpsI	GAGTC	1 cut(s)	983
Ppu21I	YACGTR	1 cut(s)	350
PshBI	ATTAAT	1 cut(s)	608
Psp124BI	GAGCTC	2 cut(s)	15, 475
Psp1406I	AACGTT	1 cut(s)	1288
Psp6I	CCWGG	4 cut(s)	230, 466, 796, 823
PspFI	CCCAGC	1 cut(s)	283
PspGI	CCWGG	4 cut(s)	230, 466, 796, 823
PspN4I	GGNNCC	2 cut(s)	533, 898
PspPI	GGNCC	6 cut(s)	275, 458, 531, 691, 897, 1171
PstI	CTGCAG	1 cut(s)	109
PsuI	RGATCY	3 cut(s)	101, 159, 827
PsyI	GACNNNGTC	1 cut(s)	456
PvuII	CAGCTG	2 cut(s)	110, 283
RsaI	GTAC	2 cut(s)	289, 1246
RsaNI	GTAC	2 cut(s)	288, 1245
RseI	CAYNNNNRTG	3 cut(s)	396, 654, 739
SacI	GAGCTC	2 cut(s)	15, 475
SalI	GTCGAC	1 cut(s)	819
SaqAI	TTAA	3 cut(s)	207, 608, 999
SatI	GCNGC	3 cut(s)	108, 300, 416
Sau3AI	GATC	7 cut(s)	101, 159, 249, 601, 793, 827, 1092
Sau96I	GGNCC	6 cut(s)	275, 458, 531, 691, 897, 1171
SchI	GAGTC	1 cut(s)	983
ScrFI	CCNGG	4 cut(s)	232, 468, 798, 825
SduI	GDGCHC	3 cut(s)	15, 403, 475
SfaNI	GCATC	7 cut(s)	126, 211, 353, 1087, 1108, 1130, 1283
SfcI	CTRYAG	2 cut(s)	105, 375
SinI	GGWCC	3 cut(s)	458, 897, 1171
SmiMI	CAYNNNNRTG	3 cut(s)	396, 654, 739
SmlI	CTYRAG	1 cut(s)	448
SmoI	CTYRAG	1 cut(s)	448
Sse9I	AATT	2 cut(s)	1101, 1269
SsiI	CCGC	5 cut(s)	64, 199, 300, 641, 725
SspMI	CTAG	3 cut(s)	132, 327, 1026
SstI	GAGCTC	2 cut(s)	15, 475
StyD4I	CCNGG	4 cut(s)	230, 466, 796, 823
StyI	CCWWGG	2 cut(s)	131, 852
TaaI	ACNGT	4 cut(s)	188, 337, 372, 504
TaiI	ACGT	4 cut(s)	352, 457, 862, 1291
TaqI	TCGA	2 cut(s)	820, 1095
TasI	AATT	2 cut(s)	1101, 1269
TauI	GCSGC	1 cut(s)	302
Tru1I	TTAA	3 cut(s)	207, 608, 999
Tru9I	TTAA	3 cut(s)	207, 608, 999
TscAI	CASTG	4 cut(s)	31, 277, 417, 1027
TseI	GCWGC	2 cut(s)	107, 415
TspDTI	ATGAA	6 cut(s)	302, 744, 971, 1095, 1155, 1221
TspGWI	ACGGA	1 cut(s)	47
TspRI	CASTG	4 cut(s)	31, 277, 417, 1027
Tth111I	GACNNNGTC	1 cut(s)	456
Van91I	CCANNNNNTGG	1 cut(s)	231
VpaK11BI	GGWCC	3 cut(s)	458, 897, 1171
VspI	ATTAAT	1 cut(s)	608
XagI	CCTNNNNNAGG	1 cut(s)	465
XceI	RCATGY	1 cut(s)	701
XmaJI	CCTAGG	1 cut(s)	131
XmiI	GTMKAC	1 cut(s)	820
XmnI	GAANNNNTTC	2 cut(s)	774, 978
XspI	CTAG	3 cut(s)	132, 327, 1026
Zsp2I	ATGCAT	2 cut(s)	141, 1123

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.