Rmu_sc0007232.1_g000004

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007232.1
Physical Location & Seq
Reverse (-)
11609 .. 13077
1469 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007232.1_g000004.1.cds

Sequence Viewer

Length: 996 bp
atgcaggtagagagagttcaggcattggcccttggcaggctcaacgagttaccggaaaagttcatccgcccctcccacgaccagcccttgaacaccagggccgtggagggaatagccgtgccggtaatttccctagcaaagccacacaacgtcatcgtcgaggaagtttccgaggcagctgcccaatggggcttctttctgatcactgaccatgggataccagcttcattgatagaggagttacagaaggttggcaaggagttttatatgctgccacaggaggaaaaagaggtctatgcaaatgaccccgctagtggcagatttgatgggtatgggactaggatgaccaagaaccatgatgacaaggttgagtggattgactatttctttcaccacactgctcctccatctaaggttaactatgatatctggcctaagaatcctccatcatacaggcaagtaaatgaagagtacaagaaggaaatgctgagagtaacggacaagctattggaggtgctttcagagggtctaggcctggataggaaggtattgaaatctcatatgggagatggagaagtggaattggaaatgaagataaatatgtacccgccatgcccacaacccgaactagcccttggcgttgagcctcacaccgacatgtccgccctcaccttactggtttcaaacgatgttcctggccttcagctgtggaaagatgacaattgggttgctgtgaattacctgccaaatgcattctttgttaacattggtgatcagatggaggtcttgagcaatggtaagtacaagagtgttcttcacaggagcttggtgaacaaggaacggttgcgcatgtcatgggctgtgttcattgcgccaccacgtgaggctgtgattgggcctctgacggagcttgtggacgagcaaaatcctgccaaatactcaaccaaaacatatggtgaataccgacaccgcaaattcaacaagatcccacagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

331

Amino Acids

37.84

Weight (kDa)

5.65

Isoelectric Point (pI)

39.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 848
Acc36I ACCTGC 1 cut(s) 750
AciI CCGC 5 cut(s) 67, 309, 608, 663, 970
AclWI GGATC 1 cut(s) 979
AcsI RAATTY 1 cut(s) 974
AcuI CTGAAG 1 cut(s) 686
AcvI CACGTG 1 cut(s) 881
AdeI CACNNNGTG 1 cut(s) 881
AfaI GTAC 3 cut(s) 473, 605, 803
AfiI CCNNNNNNNGG 2 cut(s) 36, 314
AflIII ACRYGT 1 cut(s) 657
AgsI TTSAA 4 cut(s) 91, 553, 684, 979
AjnI CCWGG 3 cut(s) 95, 534, 694
AjuI GAANNNNNNNTTGG 2 cut(s) 618, 650
AluBI AGCT 6 cut(s) 179, 224, 505, 706, 825, 910
AluI AGCT 6 cut(s) 179, 224, 505, 706, 825, 910
AlwI GGATC 1 cut(s) 979
AoxI GGCC 6 cut(s) 27, 99, 431, 532, 697, 896
ApeKI GCWGC 3 cut(s) 176, 179, 271
ApoI RAATTY 1 cut(s) 974
AspLEI GCGC 2 cut(s) 849, 874
AspS9I GGNCC 3 cut(s) 28, 99, 896
AsuHPI GGTGA 5 cut(s) 383, 661, 782, 841, 968
BbrPI CACGTG 1 cut(s) 881
BbvI GCAGC 3 cut(s) 166, 188, 258
BccI CCATC 5 cut(s) 320, 415, 454, 563, 772
BceAI ACGGC 2 cut(s) 86, 101
BcgI CGANNNNNNTGC 2 cut(s) 161, 195
BciT130I CCWGG 3 cut(s) 97, 536, 696
BciVI GTATCC 1 cut(s) 210
BclI TGATCA 2 cut(s) 201, 772
BfaI CTAG 5 cut(s) 134, 312, 339, 530, 629
BfuAI ACCTGC 1 cut(s) 750
BfuI GTATCC 1 cut(s) 210
BisI GCNGC 3 cut(s) 177, 180, 272
BlsI GCNGC 3 cut(s) 178, 181, 273
Bme1390I CCNGG 3 cut(s) 97, 536, 696
BmgT120I GGNCC 3 cut(s) 28, 99, 896
BmrFI CCNGG 3 cut(s) 97, 536, 696
BpuEI CTTGAG 1 cut(s) 808
BsaAI YACGTR 1 cut(s) 881
BsaJI CCNNGG 6 cut(s) 31, 96, 102, 171, 211, 634
BsaWI WCCGGW 1 cut(s) 52
BsaXI ACNNNNNCTCC 2 cut(s) 388, 418
Bsc4I CCNNNNNNNGG 2 cut(s) 36, 314
Bse118I RCCGGY 1 cut(s) 121
Bse1I ACTGG 1 cut(s) 681
Bse3DI GCAATG 2 cut(s) 799, 867
BseBI CCWGG 3 cut(s) 97, 536, 696
BseDI CCNNGG 6 cut(s) 31, 96, 102, 171, 211, 634
BseGI GGATG 2 cut(s) 63, 348
BseLI CCNNNNNNNGG 2 cut(s) 36, 314
BseMI GCAATG 2 cut(s) 799, 867
BseMII CTCAG 1 cut(s) 479
BseNI ACTGG 1 cut(s) 681
BseRI GAGGAG 2 cut(s) 251, 393
BseXI GCAGC 3 cut(s) 166, 188, 258
BshFI GGCC 6 cut(s) 29, 101, 433, 534, 699, 898
BsiSI CCGG 2 cut(s) 53, 122
BslFI GGGAC 1 cut(s) 349
BslI CCNNNNNNNGG 2 cut(s) 36, 314
BsmFI GGGAC 1 cut(s) 349
BsmI GAATGC 1 cut(s) 752
BsnI GGCC 6 cut(s) 29, 101, 433, 534, 699, 898
Bsp143I GATC 3 cut(s) 201, 772, 984
Bsp19I CCATGG 1 cut(s) 211
BspACI CCGC 5 cut(s) 67, 309, 608, 663, 970
BspANI GGCC 6 cut(s) 29, 101, 433, 534, 699, 898
BspCNI CTCAG 1 cut(s) 480
BspMI ACCTGC 1 cut(s) 750
BspPI GGATC 1 cut(s) 979
BsrDI GCAATG 2 cut(s) 799, 867
BsrFI RCCGGY 1 cut(s) 121
BsrI ACTGG 1 cut(s) 681
BssAI RCCGGY 1 cut(s) 121
BssECI CCNNGG 6 cut(s) 31, 96, 102, 171, 211, 634
BssMI GATC 3 cut(s) 201, 772, 984
BssT1I CCWWGG 3 cut(s) 31, 211, 634
Bst2UI CCWGG 3 cut(s) 97, 536, 696
Bst4CI ACNGT 2 cut(s) 843, 993
Bst6I CTCTTC 1 cut(s) 462
BstBAI YACGTR 1 cut(s) 881
BstC8I GCNNGC 1 cut(s) 38
BstDEI CTNAG 3 cut(s) 411, 435, 488
BstDSI CCRYGG 2 cut(s) 102, 211
BstF5I GGATG 2 cut(s) 63, 348
BstHHI GCGC 2 cut(s) 849, 874
BstKTI GATC 3 cut(s) 204, 775, 987
BstMBI GATC 3 cut(s) 201, 772, 984
BstNI CCWGG 3 cut(s) 97, 536, 696
BstNSI RCATGY 2 cut(s) 661, 853
BstSCI CCNGG 3 cut(s) 95, 534, 694
BstV1I GCAGC 3 cut(s) 166, 188, 258
BstX2I RGATCY 1 cut(s) 984
BstXI CCANNNNNNTGG 1 cut(s) 103
BstYI RGATCY 1 cut(s) 984
BsuI GTATCC 1 cut(s) 210
BsuRI GGCC 6 cut(s) 29, 101, 433, 534, 699, 898
BtgI CCRYGG 2 cut(s) 102, 211
BtsCI GGATG 2 cut(s) 63, 348
BtsI GCAGTG 1 cut(s) 396
BtsIMutI CAGTG 2 cut(s) 204, 396
BveI ACCTGC 1 cut(s) 750
Cac8I GCNNGC 1 cut(s) 38
CfoI GCGC 2 cut(s) 849, 874
Cfr10I RCCGGY 1 cut(s) 121
Cfr13I GGNCC 3 cut(s) 28, 99, 896
Csp6I GTAC 3 cut(s) 472, 604, 802
CviAII CATG 6 cut(s) 212, 356, 612, 658, 850, 855
CviQI GTAC 3 cut(s) 472, 604, 802
DdeI CTNAG 3 cut(s) 411, 435, 488
DpnI GATC 3 cut(s) 203, 774, 986
DpnII GATC 3 cut(s) 201, 772, 984
DraIII CACNNNGTG 1 cut(s) 881
Eam1104I CTCTTC 1 cut(s) 462
EarI CTCTTC 1 cut(s) 462
EciI GGCGGA 2 cut(s) 56, 652
Eco130I CCWWGG 3 cut(s) 31, 211, 634
Eco147I AGGCCT 1 cut(s) 534
Eco32I GATATC 1 cut(s) 427
Eco57I CTGAAG 1 cut(s) 686
Eco72I CACGTG 1 cut(s) 881
EcoRII CCWGG 3 cut(s) 95, 534, 694
EcoRV GATATC 1 cut(s) 427
EcoT14I CCWWGG 3 cut(s) 31, 211, 634
EcoT22I ATGCAT 1 cut(s) 754
ErhI CCWWGG 3 cut(s) 31, 211, 634
FaeI CATG 6 cut(s) 215, 359, 615, 661, 853, 858
FaqI GGGAC 1 cut(s) 349
FatI CATG 6 cut(s) 211, 355, 611, 657, 849, 854
FauI CCCGC 2 cut(s) 316, 615
FauNDI CATATG 2 cut(s) 561, 952
FbaI TGATCA 2 cut(s) 201, 772
Fnu4HI GCNGC 3 cut(s) 177, 180, 272
FokI GGATG 2 cut(s) 50, 355
Fsp4HI GCNGC 3 cut(s) 177, 180, 272
FspBI CTAG 5 cut(s) 134, 312, 339, 530, 629
FspI TGCGCA 1 cut(s) 848
GlaI GCGC 2 cut(s) 848, 873
GluI GCNGC 3 cut(s) 177, 180, 272
HaeIII GGCC 6 cut(s) 29, 101, 433, 534, 699, 898
HapII CCGG 2 cut(s) 53, 122
HhaI GCGC 2 cut(s) 849, 874
Hin1II CATG 6 cut(s) 215, 359, 615, 661, 853, 858
Hin6I GCGC 2 cut(s) 847, 872
HinP1I GCGC 2 cut(s) 847, 872
HincII GTYRAC 2 cut(s) 418, 763
HindII GTYRAC 2 cut(s) 418, 763
HinfI GANTC 1 cut(s) 439
HpaI GTTAAC 2 cut(s) 418, 763
HpaII CCGG 2 cut(s) 53, 122
HphI GGTGA 5 cut(s) 383, 661, 782, 841, 968
Hpy166II GTNNAC 4 cut(s) 418, 763, 832, 916
Hpy188I TCNGA 5 cut(s) 172, 201, 523, 777, 903
Hpy188III TCNNGA 1 cut(s) 787
Hpy8I GTNNAC 4 cut(s) 418, 763, 832, 916
Hpy99I CGWCG 1 cut(s) 161
HpyAV CCTTC 4 cut(s) 241, 472, 538, 710
HpyCH4III ACNGT 2 cut(s) 843, 993
HpyCH4IV ACGT 2 cut(s) 150, 880
HpyCH4V TGCA 3 cut(s) 4, 299, 752
HpyF3I CTNAG 3 cut(s) 411, 435, 488
HpySE526I ACGT 2 cut(s) 150, 880
Hsp92II CATG 6 cut(s) 215, 359, 615, 661, 853, 858
HspAI GCGC 2 cut(s) 847, 872
Ksp22I TGATCA 2 cut(s) 201, 772
KspAI GTTAAC 2 cut(s) 418, 763
Kzo9I GATC 3 cut(s) 201, 772, 984
LmnI GCTCC 3 cut(s) 406, 822, 907
Lsp1109I GCAGC 3 cut(s) 166, 188, 258
MaeI CTAG 5 cut(s) 134, 312, 339, 530, 629
MaeII ACGT 2 cut(s) 150, 880
MaeIII GTNAC 3 cut(s) 48, 240, 493
MalI GATC 3 cut(s) 203, 774, 986
MboI GATC 3 cut(s) 201, 772, 984
MboII GAAGA 3 cut(s) 479, 604, 806
MfeI CAATTG 1 cut(s) 721
MflI RGATCY 1 cut(s) 984
MluCI AATT 5 cut(s) 126, 581, 721, 736, 974
Mph1103I ATGCAT 1 cut(s) 754
MseI TTAA 2 cut(s) 417, 762
MslI CAYNNNNRTG 1 cut(s) 656
MspA1I CMGCKG 2 cut(s) 179, 706
MspI CCGG 2 cut(s) 53, 122
MspR9I CCNGG 3 cut(s) 97, 536, 696
MunI CAATTG 1 cut(s) 721
Mva1269I GAATGC 1 cut(s) 752
MvaI CCWGG 3 cut(s) 97, 536, 696
NcoI CCATGG 1 cut(s) 211
NdeI CATATG 2 cut(s) 561, 952
NdeII GATC 3 cut(s) 201, 772, 984
NlaIII CATG 6 cut(s) 215, 359, 615, 661, 853, 858
NsbI TGCGCA 1 cut(s) 848
NsiI ATGCAT 1 cut(s) 754
NspI RCATGY 2 cut(s) 661, 853
PceI AGGCCT 1 cut(s) 534
PciI ACATGT 1 cut(s) 657
PcsI WCGNNNNNNNCGW 1 cut(s) 156
PctI GAATGC 1 cut(s) 752
PfeI GAWTC 1 cut(s) 439
PkrI GCNGC 3 cut(s) 178, 181, 273
PmaCI CACGTG 1 cut(s) 881
PmlI CACGTG 1 cut(s) 881
Ppu21I YACGTR 1 cut(s) 881
PscI ACATGT 1 cut(s) 657
Psp6I CCWGG 3 cut(s) 95, 534, 694
PspCI CACGTG 1 cut(s) 881
PspGI CCWGG 3 cut(s) 95, 534, 694
PspPI GGNCC 3 cut(s) 28, 99, 896
PsrI GAACNNNNNNTAC 1 cut(s) 32
PsuI RGATCY 1 cut(s) 984
PvuII CAGCTG 2 cut(s) 179, 706
RsaI GTAC 3 cut(s) 473, 605, 803
RsaNI GTAC 3 cut(s) 472, 604, 802
RseI CAYNNNNRTG 1 cut(s) 656
SaqAI TTAA 2 cut(s) 417, 762
SatI GCNGC 3 cut(s) 177, 180, 272
Sau3AI GATC 3 cut(s) 201, 772, 984
Sau96I GGNCC 3 cut(s) 28, 99, 896
ScrFI CCNGG 3 cut(s) 97, 536, 696
SmiMI CAYNNNNRTG 1 cut(s) 656
SmlI CTYRAG 1 cut(s) 787
SmoI CTYRAG 1 cut(s) 787
Sse9I AATT 5 cut(s) 126, 581, 721, 736, 974
SseBI AGGCCT 1 cut(s) 534
SsiI CCGC 5 cut(s) 67, 309, 608, 663, 970
SspMI CTAG 5 cut(s) 134, 312, 339, 530, 629
StuI AGGCCT 1 cut(s) 534
StyD4I CCNGG 3 cut(s) 95, 534, 694
StyI CCWWGG 3 cut(s) 31, 211, 634
TaaI ACNGT 2 cut(s) 843, 993
TaiI ACGT 2 cut(s) 153, 883
TaqI TCGA 1 cut(s) 159
TasI AATT 5 cut(s) 126, 581, 721, 736, 974
TatI WGTACW 2 cut(s) 471, 801
TfiI GAWTC 1 cut(s) 439
Tru1I TTAA 2 cut(s) 417, 762
Tru9I TTAA 2 cut(s) 417, 762
TscAI CASTG 2 cut(s) 211, 403
TseI GCWGC 3 cut(s) 176, 179, 271
TspDTI ATGAA 5 cut(s) 52, 216, 480, 605, 856
TspGWI ACGGA 2 cut(s) 512, 920
TspRI CASTG 2 cut(s) 211, 403
XapI RAATTY 1 cut(s) 974
XceI RCATGY 2 cut(s) 661, 853
XspI CTAG 5 cut(s) 134, 312, 339, 530, 629
Zsp2I ATGCAT 1 cut(s) 754
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.