Rmu_sc0007702.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007702.1
Physical Location & Seq
Reverse (-)
1 .. 541
541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007702.1_g000001.1.cds

Sequence Viewer

Length: 415 bp
atgcttctttctcttgtgcagagcaccatcacttcctcacctttccaatcctcctcaaccttcaagattctgagccccactacttcttctgatctccccaaaagtctctttcttggctttggaattgaacccacaacaaatgccctccaaagattcctccttttcaccaaaatctcacactttgccaaacccagaaacccctcctcactctccatcaatgcttccctgattgaagcaccagtcttatgggctggtaggctttgcatcttctatgctctcttgaagactggtttggctggatctcaagctaacccacttgtctcagatttggctgagagtgaaggtggtggtgttggtattcagtcagatgatttggggttttccaagtggttgaacagcatacagggaaaaccag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

14.69

Weight (kDa)

8.89

Isoelectric Point (pI)

54.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 307
AgsI TTSAA 5 cut(s) 64, 128, 233, 283, 394
AjuI GAANNNNNNNTTGG 2 cut(s) 275, 307
AluBI AGCT 1 cut(s) 308
AluI AGCT 1 cut(s) 308
Alw21I GWGCWC 1 cut(s) 26
Alw26I GTCTC 2 cut(s) 110, 325
AlwI GGATC 1 cut(s) 307
AsuHPI GGTGA 2 cut(s) 30, 157
BanII GRGCYC 1 cut(s) 77
BbsI GAAGAC 1 cut(s) 290
Bbv12I GWGCWC 1 cut(s) 26
BccI CCATC 2 cut(s) 35, 221
BcoDI GTCTC 2 cut(s) 110, 325
BmsI GCATC 1 cut(s) 273
BpiI GAAGAC 1 cut(s) 290
BpuEI CTTGAG 1 cut(s) 288
Bse1I ACTGG 2 cut(s) 239, 292
BseMII CTCAG 3 cut(s) 62, 324, 336
BseNI ACTGG 2 cut(s) 239, 292
BseRI GAGGAG 2 cut(s) 43, 193
BsgI GTGCAG 1 cut(s) 38
BsiHKAI GWGCWC 1 cut(s) 26
BsmAI GTCTC 2 cut(s) 110, 325
Bsp1286I GDGCHC 2 cut(s) 26, 77
Bsp143I GATC 2 cut(s) 91, 299
BspCNI CTCAG 3 cut(s) 63, 325, 335
BspPI GGATC 1 cut(s) 307
BsrI ACTGG 2 cut(s) 239, 292
BssMI GATC 2 cut(s) 91, 299
BstDEI CTNAG 3 cut(s) 71, 322, 333
BstKTI GATC 2 cut(s) 94, 302
BstMAI GTCTC 2 cut(s) 110, 325
BstMBI GATC 2 cut(s) 91, 299
BstV2I GAAGAC 1 cut(s) 290
BstX2I RGATCY 1 cut(s) 299
BstXI CCANNNNNNTGG 1 cut(s) 246
BstYI RGATCY 1 cut(s) 299
CviJI RGCY 7 cut(s) 75, 117, 251, 259, 296, 308, 332
CviKI_1 RGCY 7 cut(s) 75, 117, 251, 259, 296, 308, 332
DdeI CTNAG 3 cut(s) 71, 322, 333
DpnI GATC 2 cut(s) 93, 301
DpnII GATC 2 cut(s) 91, 299
Eco24I GRGCYC 1 cut(s) 77
EcoT38I GRGCYC 1 cut(s) 77
FaiI YATR 3 cut(s) 247, 273, 401
FriOI GRGCYC 1 cut(s) 77
HinfI GANTC 2 cut(s) 67, 153
HphI GGTGA 2 cut(s) 30, 157
Hpy188I TCNGA 4 cut(s) 72, 91, 325, 367
Hpy188III TCNNGA 2 cut(s) 64, 280
HpyAV CCTTC 2 cut(s) 70, 335
HpyCH4V TGCA 2 cut(s) 19, 264
HpyF3I CTNAG 3 cut(s) 71, 322, 333
Kzo9I GATC 2 cut(s) 91, 299
LpnPI CCDG 7 cut(s) 205, 237, 239, 252, 273, 282, 389
LweI GCATC 1 cut(s) 273
MalI GATC 2 cut(s) 93, 301
MboI GATC 2 cut(s) 91, 299
MboII GAAGA 3 cut(s) 78, 259, 295
MflI RGATCY 1 cut(s) 299
MhlI GDGCHC 2 cut(s) 26, 77
MluCI AATT 1 cut(s) 123
MnlI CCTC 7 cut(s) 46, 61, 64, 155, 167, 211, 214
NdeII GATC 2 cut(s) 91, 299
PfeI GAWTC 2 cut(s) 67, 153
PsuI RGATCY 1 cut(s) 299
Sau3AI GATC 2 cut(s) 91, 299
SduI GDGCHC 2 cut(s) 26, 77
SetI ASST 4 cut(s) 43, 62, 310, 346
SfaNI GCATC 1 cut(s) 273
SmlI CTYRAG 1 cut(s) 303
SmoI CTYRAG 1 cut(s) 303
Sse9I AATT 1 cut(s) 123
TasI AATT 1 cut(s) 123
TfiI GAWTC 2 cut(s) 67, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.