Rh7AG444400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
60334671 .. 60335108
438 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG444400.1

Sequence Viewer

Length: 438 bp
ATGCTTCTTTCTCTAGTTCAAAGCACCATCACGTCCTCACCTTTCCAATCCTCCTCAACCTTCAAGATTCTGAGCCCCACTACTTCTTCTAACCTCCCCAAAAGTCTCTTTCTTGGCTTTGGAATTGAACCCACAACAAATGCCCTTCAAAGATTCCTCCTTGTCACCAAAAGCTCACACTTTGCCAAACCCAGAAACCCCTCCTCACTCTCCATCAATGCTTCTCTGATTGAAGCACCAATCTTCTGGGCTGGTAGGCTTTGCATCTTCTATGCTCTCTTGAAGACTGGTTTGGCTGGATCTCAAGCTAACCCACTTGTCTCAGATTTGGGTGAAAATGAAGTTGGTGGTGTTGGTATTGAGTCTGATGATTTGGGGTTTTCTAAGTGGTTGAACAGCATACAGGGAAAACCAGTGAAAGACGTAGCTGATATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

145

Amino Acids

15.46

Weight (kDa)

7.87

Isoelectric Point (pI)

48.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 307
AgsI TTSAA 7 cut(s) 20, 64, 128, 149, 233, 283, 394
AjiI CACGTC 1 cut(s) 33
AjuI GAANNNNNNNTTGG 4 cut(s) 275, 307, 327, 359
AluBI AGCT 3 cut(s) 174, 308, 428
AluI AGCT 3 cut(s) 174, 308, 428
Alw26I GTCTC 2 cut(s) 110, 325
AlwI GGATC 1 cut(s) 307
AsuHPI GGTGA 3 cut(s) 30, 157, 344
BanII GRGCYC 1 cut(s) 77
BbsI GAAGAC 1 cut(s) 290
BccI CCATC 2 cut(s) 35, 221
BcoDI GTCTC 2 cut(s) 110, 325
BfaI CTAG 1 cut(s) 14
BmgBI CACGTC 1 cut(s) 33
BmsI GCATC 1 cut(s) 273
BpiI GAAGAC 1 cut(s) 290
BpuEI CTTGAG 1 cut(s) 288
Bse1I ACTGG 2 cut(s) 292, 413
BseMII CTCAG 2 cut(s) 62, 336
BseNI ACTGG 2 cut(s) 292, 413
BseRI GAGGAG 2 cut(s) 43, 193
BsmAI GTCTC 2 cut(s) 110, 325
Bsp1286I GDGCHC 1 cut(s) 77
Bsp143I GATC 1 cut(s) 299
BspCNI CTCAG 2 cut(s) 63, 335
BspPI GGATC 1 cut(s) 307
BsrI ACTGG 2 cut(s) 292, 413
BssMI GATC 1 cut(s) 299
BstDEI CTNAG 3 cut(s) 71, 322, 384
BstKTI GATC 1 cut(s) 302
BstMAI GTCTC 2 cut(s) 110, 325
BstMBI GATC 1 cut(s) 299
BstV2I GAAGAC 1 cut(s) 290
BstX2I RGATCY 1 cut(s) 299
BstXI CCANNNNNNTGG 1 cut(s) 246
BstYI RGATCY 1 cut(s) 299
BtrI CACGTC 1 cut(s) 33
BtsIMutI CAGTG 1 cut(s) 420
CviJI RGCY 8 cut(s) 75, 117, 174, 251, 259, 296, 308, 428
CviKI_1 RGCY 8 cut(s) 75, 117, 174, 251, 259, 296, 308, 428
DdeI CTNAG 3 cut(s) 71, 322, 384
DpnI GATC 1 cut(s) 301
DpnII GATC 1 cut(s) 299
Eco24I GRGCYC 1 cut(s) 77
EcoT38I GRGCYC 1 cut(s) 77
FaiI YATR 4 cut(s) 273, 401, 434, 436
FriOI GRGCYC 1 cut(s) 77
FspBI CTAG 1 cut(s) 14
HinfI GANTC 3 cut(s) 67, 153, 362
HphI GGTGA 3 cut(s) 30, 157, 344
Hpy188I TCNGA 4 cut(s) 72, 228, 325, 367
Hpy188III TCNNGA 2 cut(s) 64, 280
HpyAV CCTTC 2 cut(s) 70, 155
HpyCH4IV ACGT 2 cut(s) 32, 423
HpyCH4V TGCA 1 cut(s) 264
HpyF3I CTNAG 3 cut(s) 71, 322, 384
HpySE526I ACGT 2 cut(s) 32, 423
Kzo9I GATC 1 cut(s) 299
LpnPI CCDG 7 cut(s) 205, 232, 237, 273, 282, 389, 426
LweI GCATC 1 cut(s) 273
MaeI CTAG 1 cut(s) 14
MaeII ACGT 2 cut(s) 32, 423
MaeIII GTNAC 1 cut(s) 163
MalI GATC 1 cut(s) 301
MboI GATC 1 cut(s) 299
MboII GAAGA 4 cut(s) 78, 235, 259, 295
MflI RGATCY 1 cut(s) 299
MhlI GDGCHC 1 cut(s) 77
MluCI AATT 1 cut(s) 123
MlyI GAGTC 1 cut(s) 371
MnlI CCTC 7 cut(s) 46, 61, 64, 104, 167, 211, 214
NdeII GATC 1 cut(s) 299
NmuCI GTSAC 1 cut(s) 163
PfeI GAWTC 2 cut(s) 67, 153
PleI GAGTC 1 cut(s) 370
PpsI GAGTC 1 cut(s) 370
PsuI RGATCY 1 cut(s) 299
Sau3AI GATC 1 cut(s) 299
SchI GAGTC 1 cut(s) 371
SduI GDGCHC 1 cut(s) 77
SetI ASST 8 cut(s) 35, 43, 62, 96, 176, 310, 426, 430
SfaNI GCATC 1 cut(s) 273
SmlI CTYRAG 1 cut(s) 303
SmoI CTYRAG 1 cut(s) 303
Sse9I AATT 1 cut(s) 123
SspMI CTAG 1 cut(s) 14
TaiI ACGT 2 cut(s) 35, 426
TasI AATT 1 cut(s) 123
TfiI GAWTC 2 cut(s) 67, 153
TscAI CASTG 1 cut(s) 420
TseFI GTSAC 1 cut(s) 163
Tsp45I GTSAC 1 cut(s) 163
TspDTI ATGAA 1 cut(s) 354
TspRI CASTG 1 cut(s) 420
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.