Rmu_sc0037529.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037529.1
Physical Location & Seq
Reverse (-)
1 .. 541
541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037529.1_g000001.1.cds

Sequence Viewer

Length: 415 bp
atgcttctttctcttgtgcagagcaccatcacttcctcacctttccaatcctcctcaaccctcaagattctgagccccactacttcttctgatctccccaaaagtctctttcttggctttggaattgaacccacaacaaatgcgctccaaaggttcctccttttcaccaaaatctcacactttgccaaacccagaaaccccgcctcactctccatcaatgcttccctgattgaagcaccagtcttatgggctggtaggctttgcatattctatgctctcttgaagactggtttggctggatctcaagctaacccacttgtctcagatttggctgagagtgaaggtggtggtgttggtattcagtctgatgatttggggttttccaagtggttgaacagcatacagggaaaaccag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

14.64

Weight (kDa)

8.89

Isoelectric Point (pI)

52.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 201
AclWI GGATC 1 cut(s) 307
AgsI TTSAA 4 cut(s) 128, 233, 283, 394
AjuI GAANNNNNNNTTGG 2 cut(s) 275, 307
AluBI AGCT 1 cut(s) 308
AluI AGCT 1 cut(s) 308
Alw21I GWGCWC 1 cut(s) 26
Alw26I GTCTC 2 cut(s) 110, 325
AlwI GGATC 1 cut(s) 307
AspLEI GCGC 1 cut(s) 145
AsuHPI GGTGA 2 cut(s) 30, 157
BanII GRGCYC 1 cut(s) 77
BbsI GAAGAC 1 cut(s) 290
Bbv12I GWGCWC 1 cut(s) 26
BccI CCATC 2 cut(s) 35, 221
BcoDI GTCTC 2 cut(s) 110, 325
BmiI GGNNCC 1 cut(s) 155
BpiI GAAGAC 1 cut(s) 290
BpuEI CTTGAG 2 cut(s) 47, 288
Bse1I ACTGG 2 cut(s) 239, 292
BseMII CTCAG 3 cut(s) 62, 324, 336
BseNI ACTGG 2 cut(s) 239, 292
BseRI GAGGAG 1 cut(s) 43
BsgI GTGCAG 1 cut(s) 38
BsiHKAI GWGCWC 1 cut(s) 26
BsmAI GTCTC 2 cut(s) 110, 325
Bsp1286I GDGCHC 2 cut(s) 26, 77
Bsp143I GATC 2 cut(s) 91, 299
BspACI CCGC 1 cut(s) 201
BspCNI CTCAG 3 cut(s) 63, 325, 335
BspLI GGNNCC 1 cut(s) 155
BspPI GGATC 1 cut(s) 307
BsrI ACTGG 2 cut(s) 239, 292
BssMI GATC 2 cut(s) 91, 299
BstDEI CTNAG 3 cut(s) 71, 322, 333
BstHHI GCGC 1 cut(s) 145
BstKTI GATC 2 cut(s) 94, 302
BstMAI GTCTC 2 cut(s) 110, 325
BstMBI GATC 2 cut(s) 91, 299
BstV2I GAAGAC 1 cut(s) 290
BstX2I RGATCY 1 cut(s) 299
BstXI CCANNNNNNTGG 1 cut(s) 246
BstYI RGATCY 1 cut(s) 299
CfoI GCGC 1 cut(s) 145
CviJI RGCY 7 cut(s) 75, 117, 251, 259, 296, 308, 332
CviKI_1 RGCY 7 cut(s) 75, 117, 251, 259, 296, 308, 332
DdeI CTNAG 3 cut(s) 71, 322, 333
DpnI GATC 2 cut(s) 93, 301
DpnII GATC 2 cut(s) 91, 299
Eco24I GRGCYC 1 cut(s) 77
EcoT38I GRGCYC 1 cut(s) 77
FaiI YATR 4 cut(s) 247, 266, 273, 401
FauI CCCGC 1 cut(s) 208
FriOI GRGCYC 1 cut(s) 77
GlaI GCGC 1 cut(s) 144
HhaI GCGC 1 cut(s) 145
Hin6I GCGC 1 cut(s) 143
HinP1I GCGC 1 cut(s) 143
HinfI GANTC 1 cut(s) 67
HphI GGTGA 2 cut(s) 30, 157
Hpy188I TCNGA 4 cut(s) 72, 91, 325, 367
Hpy188III TCNNGA 2 cut(s) 64, 280
HpyAV CCTTC 1 cut(s) 335
HpyCH4V TGCA 2 cut(s) 19, 264
HpyF3I CTNAG 3 cut(s) 71, 322, 333
HspAI GCGC 1 cut(s) 143
Kzo9I GATC 2 cut(s) 91, 299
LmnI GCTCC 1 cut(s) 150
LpnPI CCDG 7 cut(s) 205, 237, 239, 252, 273, 282, 389
MalI GATC 2 cut(s) 93, 301
MboI GATC 2 cut(s) 91, 299
MboII GAAGA 2 cut(s) 78, 295
MflI RGATCY 1 cut(s) 299
MhlI GDGCHC 2 cut(s) 26, 77
MluCI AATT 1 cut(s) 123
MnlI CCTC 6 cut(s) 46, 61, 64, 71, 167, 214
NdeII GATC 2 cut(s) 91, 299
NlaIV GGNNCC 1 cut(s) 155
PfeI GAWTC 1 cut(s) 67
PspN4I GGNNCC 1 cut(s) 155
PsuI RGATCY 1 cut(s) 299
Sau3AI GATC 2 cut(s) 91, 299
SduI GDGCHC 2 cut(s) 26, 77
SetI ASST 4 cut(s) 43, 155, 310, 346
SmlI CTYRAG 2 cut(s) 62, 303
SmoI CTYRAG 2 cut(s) 62, 303
Sse9I AATT 1 cut(s) 123
SsiI CCGC 1 cut(s) 201
TasI AATT 1 cut(s) 123
TfiI GAWTC 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.