Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008041.1

Orthogroup ID

OG0006017

Physical Location & Seq

Genomic Coordinates Reverse (-)

37954 .. 38943

Gene Structure 990 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008041.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 504 bp

atgctgctggagcaacacagcaaatgctggatctatttgacgttgtcggaattgttcactttggcattgctggcaatgccaataactctgtctattggtgatgttaccattcctcaacagtttgctcacactggcatatgggattgggtgggaatcgaactggtgcaatgtgtgaattcgagtttgtgtctaccacagaagcccaagctagttgttggtctgaggggatcaacaggcaacacttttgtggacaatgcagcttacaggaacttcctttttcaaacttttcttgtttcctcagtggacatggaaagctcggctgtagtaatggttaacaagcttttcaaatggcttcccggtgattgtgatcctagggttatcaactttagcagaaggcaagcaggagagaacccgattcagacctttgggcttcttgcagctataaatgcttgcaaagtagttgtacagttaatcaaggacctgccagaggcaggatatgcataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PNP_UDP_1

Protein Analysis

167

Amino Acids

18.49

Weight (kDa)

6.07

Isoelectric Point (pI)

32.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006017)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G24340 AT4G24350 AT4G24350 AT4G24350 AT4G24350
malus_domestica	MD01G1098600.v1.1
prunus_persica	Prupe.2G204100_v2.0.a1 Prupe.2G204100_v2.0.a1 Prupe.2G204100_v2.0.a1 Prupe.2G204400_v2.0.a1 Prupe.2G204400_v2.0.a1 Prupe.2G204400_v2.0.a1
pyrus_communis	pycom01g12550 pycom01g12560
rosa_chinensis	RchiOBHm_Chr1g0361871 RchiOBHm_Chr1g0361891
rosa_laevigata	RLG00000027691 RLG00000027695
rosa_multiflora	Rmu_sc0008041.1_g000012 Rmu_ssc0000124.1_g000012
rosa_rugosa	Rorug01G0292200
rosa_samantha	Rh1AG302700 Rh1BG265800 Rh1CG283900 Rh1CG284100 Rh1DG295800
rosa_wichuraiana	Rw1G026820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	489
AccI	GTMKAC	1 cut(s)	190
AclWI	GGATC	3 cut(s)	38, 235, 362
AcsI	RAATTY	1 cut(s)	175
AfaI	GTAC	1 cut(s)	465
AfiI	CCNNNNNNNGG	2 cut(s)	487, 491
AgsI	TTSAA	2 cut(s)	281, 346
AleI	CACNNNNGTG	1 cut(s)	245
AluBI	AGCT	5 cut(s)	208, 260, 315, 340, 440
AluI	AGCT	5 cut(s)	208, 260, 315, 340, 440
AlwI	GGATC	3 cut(s)	38, 235, 362
ApeKI	GCWGC	3 cut(s)	4, 257, 437
ApoI	RAATTY	1 cut(s)	175
AspA2I	CCTAGG	1 cut(s)	371
AspS9I	GGNCC	1 cut(s)	478
AsuC2I	CCSGG	1 cut(s)	357
AsuHPI	GGTGA	2 cut(s)	110, 371
AvaII	GGWCC	1 cut(s)	478
AvrII	CCTAGG	1 cut(s)	371
BbvI	GCAGC	2 cut(s)	269, 449
BcnI	CCSGG	1 cut(s)	357
BfaI	CTAG	2 cut(s)	209, 372
BfmI	CTRYAG	1 cut(s)	321
BfuAI	ACCTGC	1 cut(s)	489
BisI	GCNGC	3 cut(s)	5, 258, 438
BlnI	CCTAGG	1 cut(s)	371
BlsI	GCNGC	3 cut(s)	6, 259, 439
Bme1390I	CCNGG	1 cut(s)	357
Bme18I	GGWCC	1 cut(s)	478
BmgT120I	GGNCC	1 cut(s)	478
BmrFI	CCNGG	1 cut(s)	357
BpmI	CTGGAG	1 cut(s)	29
BpuMI	CCSGG	1 cut(s)	357
BsaBI	GATNNNNATC	1 cut(s)	366
BsaJI	CCNNGG	1 cut(s)	371
Bsc4I	CCNNNNNNNGG	2 cut(s)	487, 491
Bse1I	ACTGG	2 cut(s)	136, 165
Bse3DI	GCAATG	3 cut(s)	65, 81, 173
Bse8I	GATNNNNATC	1 cut(s)	366
BseDI	CCNNGG	1 cut(s)	371
BseJI	GATNNNNATC	1 cut(s)	366
BseLI	CCNNNNNNNGG	2 cut(s)	487, 491
BseMI	GCAATG	3 cut(s)	65, 81, 173
BseMII	CTCAG	2 cut(s)	212, 312
BseNI	ACTGG	2 cut(s)	136, 165
BseXI	GCAGC	2 cut(s)	269, 449
BsiSI	CCGG	1 cut(s)	357
BslI	CCNNNNNNNGG	2 cut(s)	487, 491
Bsp1407I	TGTACA	1 cut(s)	463
Bsp143I	GATC	3 cut(s)	30, 227, 367
BspCNI	CTCAG	2 cut(s)	213, 311
BspMI	ACCTGC	1 cut(s)	489
BspPI	GGATC	3 cut(s)	38, 235, 362
BsrDI	GCAATG	3 cut(s)	65, 81, 173
BsrGI	TGTACA	1 cut(s)	463
BsrI	ACTGG	2 cut(s)	136, 165
BssECI	CCNNGG	1 cut(s)	371
BssMI	GATC	3 cut(s)	30, 227, 367
BssT1I	CCWWGG	1 cut(s)	371
Bst4CI	ACNGT	2 cut(s)	120, 468
BstAPI	GCANNNNNTGC	1 cut(s)	497
BstAUI	TGTACA	1 cut(s)	463
BstC8I	GCNNGC	3 cut(s)	72, 399, 451
BstDEI	CTNAG	2 cut(s)	221, 298
BstENI	CCTNNNNNAGG	1 cut(s)	485
BstKTI	GATC	3 cut(s)	33, 230, 370
BstMBI	GATC	3 cut(s)	30, 227, 367
BstMWI	GCNNNNNNNGC	5 cut(s)	10, 71, 76, 446, 497
BstSCI	CCNGG	1 cut(s)	355
BstSFI	CTRYAG	1 cut(s)	321
BstV1I	GCAGC	2 cut(s)	269, 449
BstX2I	RGATCY	1 cut(s)	30
BstYI	RGATCY	1 cut(s)	30
BtsIMutI	CAGTG	2 cut(s)	129, 306
BveI	ACCTGC	1 cut(s)	489
Cac8I	GCNNGC	3 cut(s)	72, 399, 451
Cfr13I	GGNCC	1 cut(s)	478
Csp6I	GTAC	1 cut(s)	464
CviAII	CATG	1 cut(s)	307
CviJI	RGCY	9 cut(s)	202, 208, 260, 315, 320, 340, 352, 430, 440
CviKI_1	RGCY	9 cut(s)	202, 208, 260, 315, 320, 340, 352, 430, 440
CviQI	GTAC	1 cut(s)	464
DdeI	CTNAG	2 cut(s)	221, 298
DpnI	GATC	3 cut(s)	32, 229, 369
DpnII	GATC	3 cut(s)	30, 227, 367
Eco130I	CCWWGG	1 cut(s)	371
Eco47I	GGWCC	1 cut(s)	478
EcoNI	CCTNNNNNAGG	1 cut(s)	485
EcoO109I	RGGNCCY	1 cut(s)	478
EcoRI	GAATTC	1 cut(s)	175
EcoT14I	CCWWGG	1 cut(s)	371
EcoT22I	ATGCAT	1 cut(s)	502
ErhI	CCWWGG	1 cut(s)	371
FaeI	CATG	1 cut(s)	310
FaiI	YATR	6 cut(s)	137, 139, 308, 443, 498, 502
FatI	CATG	1 cut(s)	306
FauNDI	CATATG	1 cut(s)	137
FblI	GTMKAC	1 cut(s)	190
Fnu4HI	GCNGC	3 cut(s)	5, 258, 438
Fsp4HI	GCNGC	3 cut(s)	5, 258, 438
FspBI	CTAG	2 cut(s)	209, 372
GluI	GCNGC	3 cut(s)	5, 258, 438
GsuI	CTGGAG	1 cut(s)	29
HapII	CCGG	1 cut(s)	357
Hin1II	CATG	1 cut(s)	310
HincII	GTYRAC	1 cut(s)	334
HindII	GTYRAC	1 cut(s)	334
HindIII	AAGCTT	1 cut(s)	338
HinfI	GANTC	2 cut(s)	153, 415
HpaI	GTTAAC	1 cut(s)	334
HpaII	CCGG	1 cut(s)	357
HphI	GGTGA	2 cut(s)	110, 371
Hpy166II	GTNNAC	5 cut(s)	57, 191, 250, 304, 334
Hpy188I	TCNGA	3 cut(s)	49, 222, 420
Hpy8I	GTNNAC	5 cut(s)	57, 191, 250, 304, 334
HpyAV	CCTTC	1 cut(s)	387
HpyCH4III	ACNGT	2 cut(s)	120, 468
HpyCH4IV	ACGT	1 cut(s)	41
HpyCH4V	TGCA	5 cut(s)	166, 257, 437, 453, 500
HpyF10VI	GCNNNNNNNGC	5 cut(s)	10, 71, 76, 446, 497
HpyF3I	CTNAG	2 cut(s)	221, 298
HpySE526I	ACGT	1 cut(s)	41
Hsp92II	CATG	1 cut(s)	310
KspAI	GTTAAC	1 cut(s)	334
Kzo9I	GATC	3 cut(s)	30, 227, 367
LmnI	GCTCC	1 cut(s)	10
Lsp1109I	GCAGC	2 cut(s)	269, 449
MaeI	CTAG	2 cut(s)	209, 372
MaeII	ACGT	1 cut(s)	41
MaeIII	GTNAC	1 cut(s)	103
MalI	GATC	3 cut(s)	32, 229, 369
MboI	GATC	3 cut(s)	30, 227, 367
MflI	RGATCY	1 cut(s)	30
MluCI	AATT	2 cut(s)	50, 175
MmeI	TCCRAC	1 cut(s)	27
MnlI	CCTC	4 cut(s)	123, 216, 307, 481
Mph1103I	ATGCAT	1 cut(s)	502
MseI	TTAA	2 cut(s)	333, 470
MslI	CAYNNNNRTG	1 cut(s)	245
MspI	CCGG	1 cut(s)	357
MspR9I	CCNGG	1 cut(s)	357
MwoI	GCNNNNNNNGC	5 cut(s)	10, 71, 76, 446, 497
NciI	CCSGG	1 cut(s)	357
NdeI	CATATG	1 cut(s)	137
NdeII	GATC	3 cut(s)	30, 227, 367
NlaIII	CATG	1 cut(s)	310
NmeAIII	GCCGAG	1 cut(s)	296
NsiI	ATGCAT	1 cut(s)	502
OliI	CACNNNNGTG	1 cut(s)	245
PfeI	GAWTC	2 cut(s)	153, 415
PflFI	GACNNNGTC	1 cut(s)	43
PkrI	GCNGC	3 cut(s)	6, 259, 439
PpuMI	RGGWCCY	1 cut(s)	478
Psp5II	RGGWCCY	1 cut(s)	478
PspPI	GGNCC	1 cut(s)	478
PspPPI	RGGWCCY	1 cut(s)	478
PsuI	RGATCY	1 cut(s)	30
PsyI	GACNNNGTC	1 cut(s)	43
RsaI	GTAC	1 cut(s)	465
RsaNI	GTAC	1 cut(s)	464
RseI	CAYNNNNRTG	1 cut(s)	245
SaqAI	TTAA	2 cut(s)	333, 470
SatI	GCNGC	3 cut(s)	5, 258, 438
Sau3AI	GATC	3 cut(s)	30, 227, 367
Sau96I	GGNCC	1 cut(s)	478
ScrFI	CCNGG	1 cut(s)	357
SetI	ASST	8 cut(s)	44, 210, 262, 317, 342, 425, 442, 483
SfcI	CTRYAG	1 cut(s)	321
SinI	GGWCC	1 cut(s)	478
SmiMI	CAYNNNNRTG	1 cut(s)	245
Sse9I	AATT	2 cut(s)	50, 175
SspMI	CTAG	2 cut(s)	209, 372
StyD4I	CCNGG	1 cut(s)	355
StyI	CCWWGG	1 cut(s)	371
TaaI	ACNGT	2 cut(s)	120, 468
TaiI	ACGT	1 cut(s)	44
TaqI	TCGA	2 cut(s)	156, 179
TasI	AATT	2 cut(s)	50, 175
TatI	WGTACW	1 cut(s)	463
TfiI	GAWTC	2 cut(s)	153, 415
Tru1I	TTAA	2 cut(s)	333, 470
Tru9I	TTAA	2 cut(s)	333, 470
TscAI	CASTG	2 cut(s)	136, 306
TseI	GCWGC	3 cut(s)	4, 257, 437
TspRI	CASTG	2 cut(s)	136, 306
Tth111I	GACNNNGTC	1 cut(s)	43
VpaK11BI	GGWCC	1 cut(s)	478
XagI	CCTNNNNNAGG	1 cut(s)	485
XapI	RAATTY	1 cut(s)	175
XmaJI	CCTAGG	1 cut(s)	371
XmiI	GTMKAC	1 cut(s)	190
XspI	CTAG	2 cut(s)	209, 372
Zsp2I	ATGCAT	1 cut(s)	502

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.