Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000124.1

Orthogroup ID

OG0006017

Physical Location & Seq

Genomic Coordinates Reverse (-)

50628 .. 51542

Gene Structure 915 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000124.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 426 bp

atgccaataactctgtctattggtgatgttaccattcctcaacagtttgctcacactggaatatgggattgggtgggaatcgaactggtgcaatgtgtgaattcgagtttgtgtctaccacagaagcccaagctagttgttggtctgaggggatcaacaggcaacacttttgtggacaatgcagcttacaggaacttcctttttcaaacttttcttgtttcctcagtggacatggaaagctcggctgtagtaatgacaggcttgtcaaatggctttccggtgattgtgatccgtgggttatcaaatttagcaggaaggcaagcaggagagaatccgattcagacctttgggcttcttgcagctataaatgcttgcaaagtagttgtacagttaatcaaggacctgccagaggcaggatatgcatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PNP_UDP_1

Protein Analysis

141

Amino Acids

15.05

Weight (kDa)

5.65

Isoelectric Point (pI)

24.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006017)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G24340 AT4G24350 AT4G24350 AT4G24350 AT4G24350
malus_domestica	MD01G1098600.v1.1
prunus_persica	Prupe.2G204100_v2.0.a1 Prupe.2G204100_v2.0.a1 Prupe.2G204100_v2.0.a1 Prupe.2G204400_v2.0.a1 Prupe.2G204400_v2.0.a1 Prupe.2G204400_v2.0.a1
pyrus_communis	pycom01g12550 pycom01g12560
rosa_chinensis	RchiOBHm_Chr1g0361871 RchiOBHm_Chr1g0361891
rosa_laevigata	RLG00000027691 RLG00000027695
rosa_multiflora	Rmu_sc0008041.1_g000012 Rmu_ssc0000124.1_g000012
rosa_rugosa	Rorug01G0292200
rosa_samantha	Rh1AG302700 Rh1BG265800 Rh1CG283900 Rh1CG284100 Rh1DG295800
rosa_wichuraiana	Rw1G026820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	262
Acc36I	ACCTGC	1 cut(s)	411
AccI	GTMKAC	1 cut(s)	115
AclWI	GGATC	2 cut(s)	160, 283
AcsI	RAATTY	2 cut(s)	100, 304
AfaI	GTAC	1 cut(s)	387
AfiI	CCNNNNNNNGG	2 cut(s)	409, 413
AgsI	TTSAA	1 cut(s)	206
AjuI	GAANNNNNNNTTGG	2 cut(s)	52, 84
AleI	CACNNNNGTG	1 cut(s)	170
AluBI	AGCT	4 cut(s)	133, 185, 240, 362
AluI	AGCT	4 cut(s)	133, 185, 240, 362
AlwI	GGATC	2 cut(s)	160, 283
ApeKI	GCWGC	2 cut(s)	182, 359
ApoI	RAATTY	2 cut(s)	100, 304
AspS9I	GGNCC	1 cut(s)	400
AsuHPI	GGTGA	2 cut(s)	35, 292
AvaII	GGWCC	1 cut(s)	400
BbvI	GCAGC	2 cut(s)	194, 371
BfaI	CTAG	1 cut(s)	134
BfmI	CTRYAG	1 cut(s)	246
BfuAI	ACCTGC	1 cut(s)	411
BisI	GCNGC	2 cut(s)	183, 360
BlsI	GCNGC	2 cut(s)	184, 361
Bme18I	GGWCC	1 cut(s)	400
BmgT120I	GGNCC	1 cut(s)	400
BsaBI	GATNNNNATC	1 cut(s)	287
BsaJI	CCNNGG	1 cut(s)	292
BsaWI	WCCGGW	1 cut(s)	277
Bsc4I	CCNNNNNNNGG	2 cut(s)	409, 413
Bse1I	ACTGG	2 cut(s)	61, 90
Bse3DI	GCAATG	1 cut(s)	98
Bse8I	GATNNNNATC	1 cut(s)	287
BseDI	CCNNGG	1 cut(s)	292
BseJI	GATNNNNATC	1 cut(s)	287
BseLI	CCNNNNNNNGG	2 cut(s)	409, 413
BseMI	GCAATG	1 cut(s)	98
BseMII	CTCAG	2 cut(s)	137, 237
BseNI	ACTGG	2 cut(s)	61, 90
BseXI	GCAGC	2 cut(s)	194, 371
BsiSI	CCGG	1 cut(s)	278
BslI	CCNNNNNNNGG	2 cut(s)	409, 413
Bsp1407I	TGTACA	1 cut(s)	385
Bsp143I	GATC	2 cut(s)	152, 288
BspCNI	CTCAG	2 cut(s)	138, 236
BspMI	ACCTGC	1 cut(s)	411
BspPI	GGATC	2 cut(s)	160, 283
BsrDI	GCAATG	1 cut(s)	98
BsrGI	TGTACA	1 cut(s)	385
BsrI	ACTGG	2 cut(s)	61, 90
BssECI	CCNNGG	1 cut(s)	292
BssMI	GATC	2 cut(s)	152, 288
Bst4CI	ACNGT	2 cut(s)	45, 390
BstAPI	GCANNNNNTGC	1 cut(s)	419
BstAUI	TGTACA	1 cut(s)	385
BstC8I	GCNNGC	2 cut(s)	321, 373
BstDEI	CTNAG	2 cut(s)	146, 223
BstDSI	CCRYGG	1 cut(s)	292
BstENI	CCTNNNNNAGG	1 cut(s)	407
BstKTI	GATC	2 cut(s)	155, 291
BstMBI	GATC	2 cut(s)	152, 288
BstMWI	GCNNNNNNNGC	2 cut(s)	368, 419
BstSFI	CTRYAG	1 cut(s)	246
BstV1I	GCAGC	2 cut(s)	194, 371
BtgI	CCRYGG	1 cut(s)	292
BtsIMutI	CAGTG	2 cut(s)	54, 231
BveI	ACCTGC	1 cut(s)	411
Cac8I	GCNNGC	2 cut(s)	321, 373
Cfr13I	GGNCC	1 cut(s)	400
Csp6I	GTAC	1 cut(s)	386
CviAII	CATG	1 cut(s)	232
CviJI	RGCY	9 cut(s)	127, 133, 185, 240, 245, 261, 273, 352, 362
CviKI_1	RGCY	9 cut(s)	127, 133, 185, 240, 245, 261, 273, 352, 362
CviQI	GTAC	1 cut(s)	386
DdeI	CTNAG	2 cut(s)	146, 223
DpnI	GATC	2 cut(s)	154, 290
DpnII	GATC	2 cut(s)	152, 288
DrdI	GACNNNNNNGTC	1 cut(s)	262
DseDI	GACNNNNNNGTC	1 cut(s)	262
Eco47I	GGWCC	1 cut(s)	400
EcoNI	CCTNNNNNAGG	1 cut(s)	407
EcoO109I	RGGNCCY	1 cut(s)	400
EcoRI	GAATTC	1 cut(s)	100
EcoT22I	ATGCAT	1 cut(s)	424
FaeI	CATG	1 cut(s)	235
FaiI	YATR	5 cut(s)	64, 233, 365, 420, 424
FatI	CATG	1 cut(s)	231
FblI	GTMKAC	1 cut(s)	115
Fnu4HI	GCNGC	2 cut(s)	183, 360
Fsp4HI	GCNGC	2 cut(s)	183, 360
FspBI	CTAG	1 cut(s)	134
GluI	GCNGC	2 cut(s)	183, 360
HapII	CCGG	1 cut(s)	278
Hin1II	CATG	1 cut(s)	235
HinfI	GANTC	3 cut(s)	78, 331, 337
HpaII	CCGG	1 cut(s)	278
HphI	GGTGA	2 cut(s)	35, 292
Hpy166II	GTNNAC	3 cut(s)	116, 175, 229
Hpy188I	TCNGA	3 cut(s)	147, 336, 342
Hpy8I	GTNNAC	3 cut(s)	116, 175, 229
HpyAV	CCTTC	1 cut(s)	309
HpyCH4III	ACNGT	2 cut(s)	45, 390
HpyCH4V	TGCA	5 cut(s)	91, 182, 359, 375, 422
HpyF10VI	GCNNNNNNNGC	2 cut(s)	368, 419
HpyF3I	CTNAG	2 cut(s)	146, 223
Hsp92II	CATG	1 cut(s)	235
Kzo9I	GATC	2 cut(s)	152, 288
Lsp1109I	GCAGC	2 cut(s)	194, 371
MaeI	CTAG	1 cut(s)	134
MaeIII	GTNAC	1 cut(s)	28
MalI	GATC	2 cut(s)	154, 290
MboI	GATC	2 cut(s)	152, 288
MluCI	AATT	2 cut(s)	100, 304
MnlI	CCTC	4 cut(s)	48, 141, 232, 403
Mph1103I	ATGCAT	1 cut(s)	424
MseI	TTAA	1 cut(s)	392
MslI	CAYNNNNRTG	1 cut(s)	170
MspI	CCGG	1 cut(s)	278
MwoI	GCNNNNNNNGC	2 cut(s)	368, 419
NdeII	GATC	2 cut(s)	152, 288
NlaIII	CATG	1 cut(s)	235
NmeAIII	GCCGAG	1 cut(s)	221
NsiI	ATGCAT	1 cut(s)	424
OliI	CACNNNNGTG	1 cut(s)	170
PfeI	GAWTC	3 cut(s)	78, 331, 337
PkrI	GCNGC	2 cut(s)	184, 361
PpuMI	RGGWCCY	1 cut(s)	400
Psp5II	RGGWCCY	1 cut(s)	400
PspPI	GGNCC	1 cut(s)	400
PspPPI	RGGWCCY	1 cut(s)	400
RsaI	GTAC	1 cut(s)	387
RsaNI	GTAC	1 cut(s)	386
RseI	CAYNNNNRTG	1 cut(s)	170
SaqAI	TTAA	1 cut(s)	392
SatI	GCNGC	2 cut(s)	183, 360
Sau3AI	GATC	2 cut(s)	152, 288
Sau96I	GGNCC	1 cut(s)	400
SetI	ASST	6 cut(s)	135, 187, 242, 347, 364, 405
SfcI	CTRYAG	1 cut(s)	246
SinI	GGWCC	1 cut(s)	400
SmiMI	CAYNNNNRTG	1 cut(s)	170
Sse9I	AATT	2 cut(s)	100, 304
SspMI	CTAG	1 cut(s)	134
TaaI	ACNGT	2 cut(s)	45, 390
TaqI	TCGA	2 cut(s)	81, 104
TasI	AATT	2 cut(s)	100, 304
TatI	WGTACW	1 cut(s)	385
TfiI	GAWTC	3 cut(s)	78, 331, 337
Tru1I	TTAA	1 cut(s)	392
Tru9I	TTAA	1 cut(s)	392
TscAI	CASTG	2 cut(s)	61, 231
TseI	GCWGC	2 cut(s)	182, 359
TspGWI	ACGGA	1 cut(s)	281
TspRI	CASTG	2 cut(s)	61, 231
VpaK11BI	GGWCC	1 cut(s)	400
XagI	CCTNNNNNAGG	1 cut(s)	407
XapI	RAATTY	2 cut(s)	100, 304
XmiI	GTMKAC	1 cut(s)	115
XspI	CTAG	1 cut(s)	134
Zsp2I	ATGCAT	1 cut(s)	424

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.