Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008352.1

Orthogroup ID

OG0006214

Physical Location & Seq

Genomic Coordinates Reverse (-)

9396 .. 11032

Gene Structure 1637 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008352.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 732 bp

atgagaggggcaaaatcatcaagagtctttcctgggcttggaagatgttctgggaaaaagcctgtagaaagttgcaaggttaataagggtgttagcaaagttgagatcatcgatcttgacgacgacgatgatgtcattgacatcgatgatatcgagcagccacaatctcgagcaagggagcagttatgtgctcaaggtgttaatgttactcctgttcaaaacaatattatcactgatcgtgaaaagctcaaggaaactgatgaatacaagcaagcaatggaagaagaaatggaatccaggcggcaagtcttacaaattcaggcagaagaggcacagagattgcgtaagaggaaaaaagctgaaagcatgcgcttattggacatgcagagaagacaaaagcaacgcgtggaagaagttagagaaactcaaaagaaggatgaagaaaatttgaacatgaaagagaaacttcgtgctgaagtaaggaaggaactcaacagattggaatcgtcatgcaatagcatggcttctttgcttcgctgcttgggaatacaagtggggtcaggtgtgcatcctttgccacaggaggtgcatgcagcttataaacgggcattattgaaatttcaccctgatcgagcatcaagaactgacatccgccagatggttgaagctgaggaaaaatttaagcttatatctcgcatgaaggagaaacttatatcaactacgtggttctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

243

Amino Acids

28.24

Weight (kDa)

9.02

Isoelectric Point (pI)

51.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006214)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G69060
fragaria_vesca	FvH4_4g29350 FvH4_4g29350 FvH4_4g29350
malus_domestica	MD13G1056900.v1.1 MD16G1056300.v1.1
prunus_persica	Prupe.1G292900_v2.0.a1 Prupe.1G292900_v2.0.a1 Prupe.1G292900_v2.0.a1 Prupe.1G292900_v2.0.a1 Prupe.1G292900_v2.0.a1
pyrus_communis	pycom13g05080 pycom16g04930
rosa_chinensis	RchiOBHm_Chr4g0437421
rosa_laevigata	RLG00000006438
rosa_multiflora	Rmu_co8026288.1_g000001 Rmu_co8466195.1_g000001 Rmu_sc0006744.1_g000002 Rmu_sc0008352.1_g000003
rosa_roxburghii	Rroxscaffold_5G00378660
rosa_rugosa	Rorug04G0301400 Rorug04G0301500
rosa_samantha	Rh4AG355500 Rh4BG365900 Rh4CG380000 Rh4DG359600
rosa_wichuraiana	Rw4G031210

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	600
AasI	GACNNNNNNGTC	1 cut(s)	131
AccII	CGCG	1 cut(s)	405
AciI	CCGC	2 cut(s)	301, 652
AcsI	RAATTY	4 cut(s)	315, 445, 617, 677
AcuI	CTGAAG	1 cut(s)	495
AfiI	CCNNNNNNNGG	2 cut(s)	38, 658
AflIII	ACRYGT	1 cut(s)	403
AgsI	TTSAA	4 cut(s)	218, 451, 616, 665
AjnI	CCWGG	2 cut(s)	31, 296
AluBI	AGCT	5 cut(s)	247, 359, 596, 668, 685
AluI	AGCT	5 cut(s)	247, 359, 596, 668, 685
Alw21I	GWGCWC	1 cut(s)	193
Ama87I	CYCGRG	1 cut(s)	168
ApeKI	GCWGC	3 cut(s)	157, 537, 593
ApoI	RAATTY	4 cut(s)	315, 445, 617, 677
Asp700I	GAANNNNTTC	1 cut(s)	46
AspLEI	GCGC	1 cut(s)	372
AsuHPI	GGTGA	1 cut(s)	614
AvaI	CYCGRG	1 cut(s)	168
BbsI	GAAGAC	1 cut(s)	397
Bbv12I	GWGCWC	1 cut(s)	193
BbvCI	CCTCAGC	1 cut(s)	669
BbvI	GCAGC	3 cut(s)	169, 524, 605
BccI	CCATC	1 cut(s)	652
BciT130I	CCWGG	2 cut(s)	33, 298
BfmI	CTRYAG	1 cut(s)	63
BisI	GCNGC	4 cut(s)	158, 302, 538, 594
BlsI	GCNGC	4 cut(s)	159, 303, 539, 595
Bme1390I	CCNGG	2 cut(s)	33, 298
BmeT110I	CYCGRG	1 cut(s)	168
BmrFI	CCNGG	2 cut(s)	33, 298
BmsI	GCATC	2 cut(s)	577, 644
BpiI	GAAGAC	1 cut(s)	397
Bpu10I	CCTNAGC	1 cut(s)	669
BpuEI	CTTGAG	2 cut(s)	177, 233
Bsa29I	ATCGAT	2 cut(s)	111, 144
BsaAI	YACGTR	1 cut(s)	723
BsaBI	GATNNNNATC	1 cut(s)	502
BsaJI	CCNNGG	1 cut(s)	32
Bsc4I	CCNNNNNNNGG	2 cut(s)	38, 658
Bse3DI	GCAATG	1 cut(s)	282
Bse8I	GATNNNNATC	1 cut(s)	502
BseBI	CCWGG	2 cut(s)	33, 298
BseCI	ATCGAT	2 cut(s)	111, 144
BseDI	CCNNGG	1 cut(s)	32
BseGI	GGATG	3 cut(s)	442, 568, 648
BseJI	GATNNNNATC	1 cut(s)	502
BseLI	CCNNNNNNNGG	2 cut(s)	38, 658
BseMI	GCAATG	1 cut(s)	282
BseMII	CTCAG	1 cut(s)	660
BseXI	GCAGC	3 cut(s)	169, 524, 605
Bsh1236I	CGCG	1 cut(s)	405
BshVI	ATCGAT	2 cut(s)	111, 144
BsiHKAI	GWGCWC	1 cut(s)	193
BsiHKCI	CYCGRG	1 cut(s)	168
BslI	CCNNNNNNNGG	2 cut(s)	38, 658
BsoBI	CYCGRG	1 cut(s)	168
Bsp1286I	GDGCHC	1 cut(s)	193
Bsp143I	GATC	4 cut(s)	105, 112, 235, 628
BspACI	CCGC	2 cut(s)	301, 652
BspCNI	CTCAG	1 cut(s)	661
BspDI	ATCGAT	2 cut(s)	111, 144
BspFNI	CGCG	1 cut(s)	405
BsrDI	GCAATG	1 cut(s)	282
BssECI	CCNNGG	1 cut(s)	32
BssMI	GATC	4 cut(s)	105, 112, 235, 628
Bst2UI	CCWGG	2 cut(s)	33, 298
Bst6I	CTCTTC	1 cut(s)	321
BstAPI	GCANNNNNTGC	1 cut(s)	574
BstBAI	YACGTR	1 cut(s)	723
BstC8I	GCNNGC	3 cut(s)	273, 368, 591
BstDEI	CTNAG	1 cut(s)	669
BstF5I	GGATG	3 cut(s)	442, 568, 648
BstFNI	CGCG	1 cut(s)	405
BstHHI	GCGC	1 cut(s)	372
BstKTI	GATC	4 cut(s)	108, 115, 238, 631
BstMBI	GATC	4 cut(s)	105, 112, 235, 628
BstMWI	GCNNNNNNNGC	2 cut(s)	329, 574
BstNI	CCWGG	2 cut(s)	33, 298
BstNSI	RCATGY	3 cut(s)	370, 385, 593
BstSCI	CCNGG	2 cut(s)	31, 296
BstSFI	CTRYAG	1 cut(s)	63
BstUI	CGCG	1 cut(s)	405
BstV1I	GCAGC	3 cut(s)	169, 524, 605
BstV2I	GAAGAC	1 cut(s)	397
Bsu15I	ATCGAT	2 cut(s)	111, 144
BsuTUI	ATCGAT	2 cut(s)	111, 144
BtsCI	GGATG	3 cut(s)	442, 568, 648
BtsIMutI	CAGTG	1 cut(s)	231
Cac8I	GCNNGC	3 cut(s)	273, 368, 591
CfoI	GCGC	1 cut(s)	372
ClaI	ATCGAT	2 cut(s)	111, 144
CviAII	CATG	7 cut(s)	367, 382, 454, 510, 520, 590, 697
CviJI	RGCY	9 cut(s)	37, 61, 160, 247, 359, 524, 596, 668, 685
CviKI_1	RGCY	9 cut(s)	37, 61, 160, 247, 359, 524, 596, 668, 685
DdeI	CTNAG	1 cut(s)	669
DpnI	GATC	4 cut(s)	107, 114, 237, 630
DpnII	GATC	4 cut(s)	105, 112, 235, 628
DrdI	GACNNNNNNGTC	1 cut(s)	131
DseDI	GACNNNNNNGTC	1 cut(s)	131
Eam1104I	CTCTTC	1 cut(s)	321
EarI	CTCTTC	1 cut(s)	321
EciI	GGCGGA	1 cut(s)	641
Eco32I	GATATC	1 cut(s)	151
Eco57I	CTGAAG	1 cut(s)	495
Eco88I	CYCGRG	1 cut(s)	168
EcoRII	CCWGG	2 cut(s)	31, 296
EcoRV	GATATC	1 cut(s)	151
FaeI	CATG	7 cut(s)	370, 385, 457, 513, 523, 593, 700
FalI	AAGNNNNNCTT	2 cut(s)	450, 482
FatI	CATG	7 cut(s)	366, 381, 453, 509, 519, 589, 696
Fnu4HI	GCNGC	4 cut(s)	158, 302, 538, 594
FokI	GGATG	3 cut(s)	449, 555, 635
Fsp4HI	GCNGC	4 cut(s)	158, 302, 538, 594
GlaI	GCGC	1 cut(s)	371
GluI	GCNGC	4 cut(s)	158, 302, 538, 594
HhaI	GCGC	1 cut(s)	372
Hin1II	CATG	7 cut(s)	370, 385, 457, 513, 523, 593, 700
Hin6I	GCGC	1 cut(s)	370
HinP1I	GCGC	1 cut(s)	370
HindIII	AAGCTT	1 cut(s)	683
HinfI	GANTC	3 cut(s)	24, 293, 503
HphI	GGTGA	1 cut(s)	614
Hpy188I	TCNGA	1 cut(s)	731
Hpy188III	TCNNGA	5 cut(s)	21, 116, 168, 239, 639
Hpy99I	CGWCG	2 cut(s)	125, 128
HpyAV	CCTTC	3 cut(s)	427, 478, 694
HpyCH4IV	ACGT	1 cut(s)	722
HpyCH4V	TGCA	6 cut(s)	75, 385, 513, 568, 589, 593
HpyF10VI	GCNNNNNNNGC	2 cut(s)	329, 574
HpyF3I	CTNAG	1 cut(s)	669
HpySE526I	ACGT	1 cut(s)	722
Hsp92II	CATG	7 cut(s)	370, 385, 457, 513, 523, 593, 700
HspAI	GCGC	1 cut(s)	370
Kzo9I	GATC	4 cut(s)	105, 112, 235, 628
LmnI	GCTCC	1 cut(s)	178
Lsp1109I	GCAGC	3 cut(s)	169, 524, 605
LweI	GCATC	2 cut(s)	577, 644
MaeII	ACGT	1 cut(s)	722
MaeIII	GTNAC	1 cut(s)	205
MalI	GATC	4 cut(s)	107, 114, 237, 630
MboI	GATC	4 cut(s)	105, 112, 235, 628
MboII	GAAGA	7 cut(s)	54, 293, 296, 338, 402, 422, 452
MhlI	GDGCHC	1 cut(s)	193
MluCI	AATT	4 cut(s)	315, 445, 617, 677
MluI	ACGCGT	1 cut(s)	403
MlyI	GAGTC	1 cut(s)	33
MnlI	CCTC	4 cut(s)	322, 342, 577, 664
MroXI	GAANNNNTTC	1 cut(s)	46
MseI	TTAA	3 cut(s)	81, 201, 681
MspR9I	CCNGG	2 cut(s)	33, 298
MvaI	CCWGG	2 cut(s)	33, 298
MvnI	CGCG	1 cut(s)	405
MwoI	GCNNNNNNNGC	2 cut(s)	329, 574
NdeII	GATC	4 cut(s)	105, 112, 235, 628
NlaIII	CATG	7 cut(s)	370, 385, 457, 513, 523, 593, 700
NspI	RCATGY	3 cut(s)	370, 385, 593
PaeI	GCATGC	2 cut(s)	370, 593
PaeR7I	CTCGAG	1 cut(s)	168
PcsI	WCGNNNNNNNCGW	2 cut(s)	117, 150
PdmI	GAANNNNTTC	1 cut(s)	46
PfeI	GAWTC	2 cut(s)	293, 503
PkrI	GCNGC	4 cut(s)	159, 303, 539, 595
PleI	GAGTC	1 cut(s)	32
PpsI	GAGTC	1 cut(s)	32
Ppu21I	YACGTR	1 cut(s)	723
PsiI	TTATAA	1 cut(s)	600
Psp6I	CCWGG	2 cut(s)	31, 296
PspGI	CCWGG	2 cut(s)	31, 296
SaqAI	TTAA	3 cut(s)	81, 201, 681
SatI	GCNGC	4 cut(s)	158, 302, 538, 594
Sau3AI	GATC	4 cut(s)	105, 112, 235, 628
SchI	GAGTC	1 cut(s)	33
ScrFI	CCNGG	2 cut(s)	33, 298
SduI	GDGCHC	1 cut(s)	193
SfaNI	GCATC	2 cut(s)	577, 644
SfcI	CTRYAG	1 cut(s)	63
Sfr274I	CTCGAG	1 cut(s)	168
SlaI	CTCGAG	1 cut(s)	168
SmlI	CTYRAG	3 cut(s)	168, 192, 248
SmoI	CTYRAG	3 cut(s)	168, 192, 248
SphI	GCATGC	2 cut(s)	370, 593
Sse9I	AATT	4 cut(s)	315, 445, 617, 677
SsiI	CCGC	2 cut(s)	301, 652
SspI	AATATT	1 cut(s)	226
StyD4I	CCNGG	2 cut(s)	31, 296
TaiI	ACGT	1 cut(s)	725
TaqI	TCGA	5 cut(s)	111, 144, 153, 169, 631
TasI	AATT	4 cut(s)	315, 445, 617, 677
TauI	GCSGC	1 cut(s)	304
TfiI	GAWTC	2 cut(s)	293, 503
Tru1I	TTAA	3 cut(s)	81, 201, 681
Tru9I	TTAA	3 cut(s)	81, 201, 681
TscAI	CASTG	1 cut(s)	238
TseI	GCWGC	3 cut(s)	157, 537, 593
TspDTI	ATGAA	4 cut(s)	276, 453, 470, 713
TspRI	CASTG	1 cut(s)	238
XapI	RAATTY	4 cut(s)	315, 445, 617, 677
XceI	RCATGY	3 cut(s)	370, 385, 593
XhoI	CTCGAG	1 cut(s)	168
XmnI	GAANNNNTTC	1 cut(s)	46

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.