Rmu_sc0008418.1_g000004

YLS9-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008418.1
Physical Location & Seq
Reverse (-)
14509 .. 15213
705 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008418.1_g000004.1.cds

Sequence Viewer

Length: 705 bp
atgagcggtggttctgagcggtctatcatcggctttctagctattaccatggcaggaatcttttttttcaccgatgtgaacagatatgttaacaatccccaccactcatacattcacgtaacccatgcttcgctcgccgagttcaataggatcaccaccgccaccatcaacacccttcactataatctcgtactccacatcaccctccaaaaccccaacaaagatttcgacgtgtattatgataatattgtagtcatggcttattatcaaaatcagaggtttattatggagagctattcacatgtagtttaccaagggaagaacgacacaactcgtctcaaactgtcactcaagggacaacaggacatggacaacactcttggggtggttgaggaggggcatcaagagaattccaaggttgagcagccgcaccaccaatgcatacatgatgacaatggcgatgaaaaaaacaagaagtttagattatctgaatatgatatttttgtcaggctttatcttcaaaatactgcaatcccaaaccctaggtcgttgatcaggatgaattggatagggaactctcaattcacatgcaacttgaaaagggttccgttgatcacaacggctaattataaccctagtcatttcatgactgctgagtgcaattccgatttctatcgagtatttcatcctcctggcagtggttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

234

Amino Acids

27.06

Weight (kDa)

6.66

Isoelectric Point (pI)

36.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 630
AccBSI CCGCTC 2 cut(s) 6, 19
AciI CCGC 4 cut(s) 6, 19, 159, 428
AclWI GGATC 1 cut(s) 158
AcsI RAATTY 1 cut(s) 409
AfaI GTAC 1 cut(s) 192
AfiI CCNNNNNNNGG 1 cut(s) 698
AflIII ACRYGT 2 cut(s) 231, 301
AgsI TTSAA 3 cut(s) 145, 521, 598
AjiI CACGTC 1 cut(s) 232
AjnI CCWGG 1 cut(s) 691
AjuI GAANNNNNNNTTGG 2 cut(s) 209, 241
AleI CACNNNNGTG 1 cut(s) 74
AluBI AGCT 2 cut(s) 41, 294
AluI AGCT 2 cut(s) 41, 294
Alw26I GTCTC 1 cut(s) 341
AlwI GGATC 1 cut(s) 158
ApeKI GCWGC 1 cut(s) 424
ApoI RAATTY 1 cut(s) 409
ArsI GACNNNNNNTTYG 2 cut(s) 530, 562
AspA2I CCTAGG 1 cut(s) 542
AsuHPI GGTGA 3 cut(s) 61, 145, 193
AvrII CCTAGG 1 cut(s) 542
BbvI GCAGC 1 cut(s) 436
BccI CCATC 1 cut(s) 173
BceAI ACGGC 1 cut(s) 636
BciT130I CCWGG 1 cut(s) 693
BclI TGATCA 2 cut(s) 552, 612
BcoDI GTCTC 1 cut(s) 341
BfaI CTAG 3 cut(s) 38, 543, 636
BisI GCNGC 2 cut(s) 425, 428
BlnI CCTAGG 1 cut(s) 542
BlsI GCNGC 2 cut(s) 426, 429
Bme1390I CCNGG 1 cut(s) 693
BmgBI CACGTC 1 cut(s) 232
BmiI GGNNCC 1 cut(s) 606
BmrFI CCNGG 1 cut(s) 693
BmsI GCATC 1 cut(s) 409
BpuEI CTTGAG 1 cut(s) 335
BsaAI YACGTR 1 cut(s) 118
BsaBI GATNNNNATC 1 cut(s) 672
BsaJI CCNNGG 4 cut(s) 48, 313, 414, 542
Bsc4I CCNNNNNNNGG 1 cut(s) 698
Bse8I GATNNNNATC 1 cut(s) 672
BseBI CCWGG 1 cut(s) 693
BseDI CCNNGG 4 cut(s) 48, 313, 414, 542
BseGI GGATG 2 cut(s) 564, 685
BseJI GATNNNNATC 1 cut(s) 672
BseLI CCNNNNNNNGG 1 cut(s) 698
BseMII CTCAG 2 cut(s) 6, 645
BseRI GAGGAG 1 cut(s) 407
BseXI GCAGC 1 cut(s) 436
BslFI GGGAC 1 cut(s) 369
BslI CCNNNNNNNGG 1 cut(s) 698
BsmAI GTCTC 1 cut(s) 341
BsmBI CGTCTC 1 cut(s) 341
BsmFI GGGAC 1 cut(s) 369
Bsp143I GATC 3 cut(s) 150, 552, 612
Bsp19I CCATGG 1 cut(s) 48
BspACI CCGC 4 cut(s) 6, 19, 159, 428
BspCNI CTCAG 2 cut(s) 7, 646
BspHI TCATGA 1 cut(s) 645
BspLI GGNNCC 1 cut(s) 606
BspPI GGATC 1 cut(s) 158
BsrBI CCGCTC 2 cut(s) 6, 19
BssECI CCNNGG 4 cut(s) 48, 313, 414, 542
BssMI GATC 3 cut(s) 150, 552, 612
BssT1I CCWWGG 4 cut(s) 48, 313, 414, 542
Bst2UI CCWGG 1 cut(s) 693
Bst4CI ACNGT 1 cut(s) 345
BstBAI YACGTR 1 cut(s) 118
BstC8I GCNNGC 1 cut(s) 135
BstDEI CTNAG 2 cut(s) 15, 654
BstDSI CCRYGG 1 cut(s) 48
BstF5I GGATG 2 cut(s) 564, 685
BstKTI GATC 3 cut(s) 153, 555, 615
BstMAI GTCTC 1 cut(s) 341
BstMBI GATC 3 cut(s) 150, 552, 612
BstMWI GCNNNNNNNGC 1 cut(s) 134
BstNI CCWGG 1 cut(s) 693
BstNSI RCATGY 2 cut(s) 305, 591
BstSCI CCNGG 1 cut(s) 691
BstV1I GCAGC 1 cut(s) 436
BtgI CCRYGG 1 cut(s) 48
BtgZI GCGATG 1 cut(s) 474
BtrI CACGTC 1 cut(s) 232
BtsCI GGATG 2 cut(s) 564, 685
BtsI GCAGTG 1 cut(s) 703
BtsIMutI CAGTG 1 cut(s) 703
Cac8I GCNNGC 1 cut(s) 135
CciI TCATGA 1 cut(s) 645
Csp6I GTAC 1 cut(s) 191
CviAII CATG 8 cut(s) 49, 125, 256, 302, 367, 446, 588, 646
CviJI RGCY 7 cut(s) 33, 41, 260, 294, 427, 511, 623
CviKI_1 RGCY 7 cut(s) 33, 41, 260, 294, 427, 511, 623
CviQI GTAC 1 cut(s) 191
DdeI CTNAG 2 cut(s) 15, 654
DpnI GATC 3 cut(s) 152, 554, 614
DpnII GATC 3 cut(s) 150, 552, 612
Eco130I CCWWGG 4 cut(s) 48, 313, 414, 542
EcoRI GAATTC 1 cut(s) 409
EcoRII CCWGG 1 cut(s) 691
EcoT14I CCWWGG 4 cut(s) 48, 313, 414, 542
EcoT22I ATGCAT 1 cut(s) 443
ErhI CCWWGG 4 cut(s) 48, 313, 414, 542
Esp3I CGTCTC 1 cut(s) 341
FaeI CATG 8 cut(s) 52, 128, 259, 305, 370, 449, 591, 649
FaqI GGGAC 1 cut(s) 369
FatI CATG 8 cut(s) 48, 124, 255, 301, 366, 445, 587, 645
FbaI TGATCA 2 cut(s) 552, 612
Fnu4HI GCNGC 2 cut(s) 425, 428
FokI GGATG 2 cut(s) 571, 672
Fsp4HI GCNGC 2 cut(s) 425, 428
FspBI CTAG 3 cut(s) 38, 543, 636
GluI GCNGC 2 cut(s) 425, 428
Hin1II CATG 8 cut(s) 52, 128, 259, 305, 370, 449, 591, 649
HincII GTYRAC 1 cut(s) 91
HindII GTYRAC 1 cut(s) 91
HinfI GANTC 1 cut(s) 57
HpaI GTTAAC 1 cut(s) 91
HphI GGTGA 3 cut(s) 61, 145, 193
Hpy166II GTNNAC 3 cut(s) 79, 91, 310
Hpy188I TCNGA 4 cut(s) 16, 276, 490, 667
Hpy188III TCNNGA 3 cut(s) 404, 556, 646
Hpy8I GTNNAC 3 cut(s) 79, 91, 310
Hpy99I CGWCG 1 cut(s) 233
HpyAV CCTTC 1 cut(s) 185
HpyCH4III ACNGT 1 cut(s) 345
HpyCH4IV ACGT 2 cut(s) 117, 231
HpyCH4V TGCA 4 cut(s) 441, 530, 591, 660
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
HpyF3I CTNAG 2 cut(s) 15, 654
HpySE526I ACGT 2 cut(s) 117, 231
Hsp92II CATG 8 cut(s) 52, 128, 259, 305, 370, 449, 591, 649
Ksp22I TGATCA 2 cut(s) 552, 612
KspAI GTTAAC 1 cut(s) 91
Kzo9I GATC 3 cut(s) 150, 552, 612
LpnPI CCDG 5 cut(s) 39, 347, 493, 541, 678
Lsp1109I GCAGC 1 cut(s) 436
LweI GCATC 1 cut(s) 409
MaeI CTAG 3 cut(s) 38, 543, 636
MaeII ACGT 2 cut(s) 117, 231
MaeIII GTNAC 2 cut(s) 118, 345
MalI GATC 3 cut(s) 152, 554, 614
MbiI CCGCTC 2 cut(s) 6, 19
MboI GATC 3 cut(s) 150, 552, 612
MboII GAAGA 2 cut(s) 331, 509
MluCI AATT 5 cut(s) 409, 562, 581, 625, 661
MnlI CCTC 5 cut(s) 215, 270, 385, 388, 699
Mph1103I ATGCAT 1 cut(s) 443
MseI TTAA 1 cut(s) 90
MslI CAYNNNNRTG 1 cut(s) 74
MspR9I CCNGG 1 cut(s) 693
MvaI CCWGG 1 cut(s) 693
MwoI GCNNNNNNNGC 1 cut(s) 134
NcoI CCATGG 1 cut(s) 48
NdeII GATC 3 cut(s) 150, 552, 612
NlaIII CATG 8 cut(s) 52, 128, 259, 305, 370, 449, 591, 649
NlaIV GGNNCC 1 cut(s) 606
NmeAIII GCCGAG 1 cut(s) 163
NmuCI GTSAC 1 cut(s) 345
NsiI ATGCAT 1 cut(s) 443
NspI RCATGY 2 cut(s) 305, 591
OliI CACNNNNGTG 1 cut(s) 74
PagI TCATGA 1 cut(s) 645
PciI ACATGT 1 cut(s) 301
PfeI GAWTC 1 cut(s) 57
PkrI GCNGC 2 cut(s) 426, 429
Ppu21I YACGTR 1 cut(s) 118
PscI ACATGT 1 cut(s) 301
PsiI TTATAA 1 cut(s) 630
Psp6I CCWGG 1 cut(s) 691
PspGI CCWGG 1 cut(s) 691
PspN4I GGNNCC 1 cut(s) 606
RsaI GTAC 1 cut(s) 192
RsaNI GTAC 1 cut(s) 191
RseI CAYNNNNRTG 1 cut(s) 74
SaqAI TTAA 1 cut(s) 90
SatI GCNGC 2 cut(s) 425, 428
Sau3AI GATC 3 cut(s) 150, 552, 612
ScrFI CCNGG 1 cut(s) 693
SetI ASST 7 cut(s) 43, 120, 234, 281, 296, 420, 548
SfaNI GCATC 1 cut(s) 409
SmiMI CAYNNNNRTG 1 cut(s) 74
SmlI CTYRAG 1 cut(s) 350
SmoI CTYRAG 1 cut(s) 350
Sse9I AATT 5 cut(s) 409, 562, 581, 625, 661
SsiI CCGC 4 cut(s) 6, 19, 159, 428
SspI AATATT 1 cut(s) 247
SspMI CTAG 3 cut(s) 38, 543, 636
StyD4I CCNGG 1 cut(s) 691
StyI CCWWGG 4 cut(s) 48, 313, 414, 542
TaaI ACNGT 1 cut(s) 345
TaiI ACGT 2 cut(s) 120, 234
TaqI TCGA 2 cut(s) 228, 676
TasI AATT 5 cut(s) 409, 562, 581, 625, 661
TauI GCSGC 1 cut(s) 430
TfiI GAWTC 1 cut(s) 57
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TscAI CASTG 1 cut(s) 703
TseFI GTSAC 1 cut(s) 345
TseI GCWGC 1 cut(s) 424
Tsp45I GTSAC 1 cut(s) 345
TspDTI ATGAA 4 cut(s) 477, 575, 634, 674
TspGWI ACGGA 1 cut(s) 597
TspRI CASTG 1 cut(s) 703
XapI RAATTY 1 cut(s) 409
XceI RCATGY 2 cut(s) 305, 591
XmaJI CCTAGG 1 cut(s) 542
XspI CTAG 3 cut(s) 38, 543, 636
Zsp2I ATGCAT 1 cut(s) 443
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.