Rh3CG011100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
695997 .. 696392
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG011100.1

Sequence Viewer

Length: 396 bp
ATGGAGCTGATTACGATATTGTTGATGAGCTCTATCGTCAAAACAAGTACCAAGTCAGCTATGGCTAGGTTGATTCGGCCGAGTTGGGAAGATAAGTCCAAGATGACATGTTACTTGGTAGTTCCCTTGATCAGTGGTTACAAGAATAACAGAGGAGCTCGATCTGCCATGTGCTATGAAGATCACTTTGATGTTGAGCTATACTTCCATTTTGTTTTTCTTTGTTTACTGGAGTTCCACTTGGTTATATTGGCTGTAGTGTTGGTTTTGATTCTTTTGGGGGCTTCTGCAGAGGCCGAAGAACAGGGTACTGCAGTACAAGTTCATATTGATAACGGTTGTACACTAATTATTGAGTTGAGAATAATATTTGATTCAGAATGGGAATGTATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

14.86

Weight (kDa)

5.09

Isoelectric Point (pI)

47.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 77
AfaI GTAC 4 cut(s) 49, 310, 318, 343
AflIII ACRYGT 1 cut(s) 107
AluBI AGCT 5 cut(s) 7, 30, 59, 158, 199
AluI AGCT 5 cut(s) 7, 30, 59, 158, 199
Alw21I GWGCWC 2 cut(s) 32, 160
AoxI GGCC 2 cut(s) 77, 294
BaeI ACNNNNGTAYC 2 cut(s) 300, 333
BanII GRGCYC 2 cut(s) 32, 160
Bbv12I GWGCWC 2 cut(s) 32, 160
BclI TGATCA 1 cut(s) 129
BfaI CTAG 1 cut(s) 66
BfmI CTRYAG 3 cut(s) 255, 288, 312
BpmI CTGGAG 1 cut(s) 251
Bse1I ACTGG 1 cut(s) 234
BseNI ACTGG 1 cut(s) 234
BseRI GAGGAG 1 cut(s) 168
BseX3I CGGCCG 1 cut(s) 77
Bsh1285I CGRYCG 1 cut(s) 80
BshFI GGCC 2 cut(s) 79, 296
BsiEI CGRYCG 1 cut(s) 80
BsiHKAI GWGCWC 2 cut(s) 32, 160
BsnI GGCC 2 cut(s) 79, 296
Bsp1286I GDGCHC 2 cut(s) 32, 160
Bsp1407I TGTACA 1 cut(s) 341
Bsp143I GATC 3 cut(s) 129, 161, 181
BspANI GGCC 2 cut(s) 79, 296
BspMAI CTGCAG 2 cut(s) 292, 316
BsrGI TGTACA 1 cut(s) 341
BsrI ACTGG 1 cut(s) 234
BssMI GATC 3 cut(s) 129, 161, 181
Bst4CI ACNGT 1 cut(s) 338
BstAUI TGTACA 1 cut(s) 341
BstKTI GATC 3 cut(s) 132, 164, 184
BstMBI GATC 3 cut(s) 129, 161, 181
BstMCI CGRYCG 1 cut(s) 80
BstMWI GCNNNNNNNGC 1 cut(s) 164
BstNSI RCATGY 1 cut(s) 111
BstSFI CTRYAG 3 cut(s) 255, 288, 312
BstZI CGGCCG 1 cut(s) 77
BsuRI GGCC 2 cut(s) 79, 296
BtsIMutI CAGTG 1 cut(s) 139
Csp6I GTAC 4 cut(s) 48, 309, 317, 342
CviAII CATG 2 cut(s) 108, 169
CviQI GTAC 4 cut(s) 48, 309, 317, 342
DpnI GATC 3 cut(s) 131, 163, 183
DpnII GATC 3 cut(s) 129, 161, 181
EaeI YGGCCR 1 cut(s) 77
EagI CGGCCG 1 cut(s) 77
Ecl136II GAGCTC 2 cut(s) 30, 158
EclXI CGGCCG 1 cut(s) 77
Eco24I GRGCYC 2 cut(s) 32, 160
Eco52I CGGCCG 1 cut(s) 77
Eco53kI GAGCTC 2 cut(s) 30, 158
EcoICRI GAGCTC 2 cut(s) 30, 158
EcoT38I GRGCYC 2 cut(s) 32, 160
FaeI CATG 2 cut(s) 111, 172
FaiI YATR 9 cut(s) 62, 109, 170, 177, 202, 248, 327, 392, 394
FatI CATG 2 cut(s) 107, 168
FbaI TGATCA 1 cut(s) 129
FriOI GRGCYC 2 cut(s) 32, 160
FspBI CTAG 1 cut(s) 66
GsuI CTGGAG 1 cut(s) 251
HaeIII GGCC 2 cut(s) 79, 296
Hin1II CATG 2 cut(s) 111, 172
HinfI GANTC 3 cut(s) 73, 271, 374
Hpy166II GTNNAC 2 cut(s) 227, 344
Hpy188I TCNGA 1 cut(s) 379
Hpy8I GTNNAC 2 cut(s) 227, 344
HpyCH4III ACNGT 1 cut(s) 338
HpyCH4V TGCA 2 cut(s) 290, 314
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
Hsp92II CATG 2 cut(s) 111, 172
Ksp22I TGATCA 1 cut(s) 129
Kzo9I GATC 3 cut(s) 129, 161, 181
LmnI GCTCC 2 cut(s) 4, 155
LpnPI CCDG 2 cut(s) 215, 290
MaeI CTAG 1 cut(s) 66
MaeIII GTNAC 2 cut(s) 110, 137
MalI GATC 3 cut(s) 131, 163, 183
MboI GATC 3 cut(s) 129, 161, 181
MboII GAAGA 3 cut(s) 101, 191, 311
MhlI GDGCHC 2 cut(s) 32, 160
MluCI AATT 1 cut(s) 348
MnlI CCTC 2 cut(s) 146, 286
MslI CAYNNNNRTG 1 cut(s) 189
MwoI GCNNNNNNNGC 1 cut(s) 164
NdeII GATC 3 cut(s) 129, 161, 181
NlaIII CATG 2 cut(s) 111, 172
NmeAIII GCCGAG 1 cut(s) 105
NspI RCATGY 1 cut(s) 111
PciI ACATGT 1 cut(s) 107
PfeI GAWTC 3 cut(s) 73, 271, 374
PscI ACATGT 1 cut(s) 107
Psp124BI GAGCTC 2 cut(s) 32, 160
PstI CTGCAG 2 cut(s) 292, 316
RsaI GTAC 4 cut(s) 49, 310, 318, 343
RsaNI GTAC 4 cut(s) 48, 309, 317, 342
RseI CAYNNNNRTG 1 cut(s) 189
SacI GAGCTC 2 cut(s) 32, 160
Sau3AI GATC 3 cut(s) 129, 161, 181
SduI GDGCHC 2 cut(s) 32, 160
SetI ASST 6 cut(s) 9, 32, 61, 71, 160, 201
SfcI CTRYAG 3 cut(s) 255, 288, 312
SmiMI CAYNNNNRTG 1 cut(s) 189
Sse9I AATT 1 cut(s) 348
SspI AATATT 1 cut(s) 369
SspMI CTAG 1 cut(s) 66
SstI GAGCTC 2 cut(s) 32, 160
TaaI ACNGT 1 cut(s) 338
TaqI TCGA 1 cut(s) 160
TasI AATT 1 cut(s) 348
TatI WGTACW 2 cut(s) 316, 341
TfiI GAWTC 3 cut(s) 73, 271, 374
TscAI CASTG 1 cut(s) 139
TspDTI ATGAA 2 cut(s) 192, 314
TspRI CASTG 1 cut(s) 139
XceI RCATGY 1 cut(s) 111
XcmI CCANNNNNNNNNTGG 1 cut(s) 58
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.