Rmu_sc0009296.1_g000014

Mitochondrial calcium uniporter

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009296.1
Physical Location & Seq
Reverse (-)
35809 .. 36204
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009296.1_g000014.1.cds

Sequence Viewer

Length: 396 bp
atgtggaggagtgggtggagaacaaccagtgttgtgctcaaggattttgtgcacaatggaggacccagaagccaaaacccatgtgctgtgtttggtttgagtcgttttgggaatgatgaggaacaatgtgggtttttgaattctcctggaaagtttcagagaagggctgggtttgcttcttctggtgggcatgtcaatggggagggtgagaatatcagtaaaggtgcaggtttgggaggaatgcccataagttttggggaggccaagaggcttatgaggcttgtgaatgtggaggctttgaagactaagattgggaaagaagggaaagaggccattccttattctgagttgcttgaggcttgtcagagcattggtgtggctagaagaatggattga

Protein Analysis

131

Amino Acids

14.13

Weight (kDa)

9.41

Isoelectric Point (pI)

46.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 218
AcsI RAATTY 1 cut(s) 139
AgsI TTSAA 2 cut(s) 139, 301
AjnI CCWGG 1 cut(s) 145
Alw21I GWGCWC 2 cut(s) 39, 54
Alw44I GTGCAC 1 cut(s) 50
AoxI GGCC 2 cut(s) 261, 330
ApaLI GTGCAC 1 cut(s) 50
ApoI RAATTY 1 cut(s) 139
AspS9I GGNCC 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 218
AvaII GGWCC 1 cut(s) 62
BaeGI GKGCMC 1 cut(s) 54
BbsI GAAGAC 1 cut(s) 308
Bbv12I GWGCWC 2 cut(s) 39, 54
BciT130I CCWGG 1 cut(s) 147
BfaI CTAG 1 cut(s) 381
BfuAI ACCTGC 1 cut(s) 218
Bme1390I CCNGG 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 62
BmgT120I GGNCC 1 cut(s) 62
BmiI GGNNCC 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 147
BpiI GAAGAC 1 cut(s) 308
BpuEI CTTGAG 2 cut(s) 23, 374
Bse1I ACTGG 1 cut(s) 27
BseBI CCWGG 1 cut(s) 147
BseMII CTCAG 1 cut(s) 336
BseNI ACTGG 1 cut(s) 27
BseRI GAGGAG 1 cut(s) 22
BseSI GKGCMC 1 cut(s) 54
BseYI CCCAGC 1 cut(s) 167
BsgI GTGCAG 1 cut(s) 246
BshFI GGCC 2 cut(s) 263, 332
BsiHKAI GWGCWC 2 cut(s) 39, 54
BsmI GAATGC 1 cut(s) 246
BsnI GGCC 2 cut(s) 263, 332
Bsp1286I GDGCHC 2 cut(s) 39, 54
BspANI GGCC 2 cut(s) 263, 332
BspCNI CTCAG 1 cut(s) 337
BspLI GGNNCC 1 cut(s) 64
BspMI ACCTGC 1 cut(s) 218
BsrI ACTGG 1 cut(s) 27
Bst2UI CCWGG 1 cut(s) 147
BstDEI CTNAG 2 cut(s) 306, 345
BstMWI GCNNNNNNNGC 2 cut(s) 173, 277
BstNI CCWGG 1 cut(s) 147
BstNSI RCATGY 1 cut(s) 194
BstSCI CCNGG 1 cut(s) 145
BstSLI GKGCMC 1 cut(s) 54
BstV2I GAAGAC 1 cut(s) 308
BsuRI GGCC 2 cut(s) 263, 332
BtsIMutI CAGTG 1 cut(s) 34
BveI ACCTGC 1 cut(s) 218
Cfr13I GGNCC 1 cut(s) 62
CviAII CATG 2 cut(s) 81, 191
CviJI RGCY 9 cut(s) 72, 167, 263, 271, 280, 296, 332, 359, 380
CviKI_1 RGCY 9 cut(s) 72, 167, 263, 271, 280, 296, 332, 359, 380
DdeI CTNAG 2 cut(s) 306, 345
Eco47I GGWCC 1 cut(s) 62
EcoO109I RGGNCCY 1 cut(s) 62
EcoRI GAATTC 1 cut(s) 139
EcoRII CCWGG 1 cut(s) 145
FaeI CATG 2 cut(s) 84, 194
FaiI YATR 4 cut(s) 82, 192, 248, 275
FatI CATG 2 cut(s) 80, 190
FspBI CTAG 1 cut(s) 381
GsaI CCCAGC 1 cut(s) 171
HaeIII GGCC 2 cut(s) 263, 332
Hin1II CATG 2 cut(s) 84, 194
HinfI GANTC 1 cut(s) 100
HphI GGTGA 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 3 cut(s) 159, 346, 366
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 2 cut(s) 156, 314
HpyCH4V TGCA 2 cut(s) 52, 227
HpyF10VI GCNNNNNNNGC 2 cut(s) 173, 277
HpyF3I CTNAG 2 cut(s) 306, 345
Hsp92II CATG 2 cut(s) 84, 194
LpnPI CCDG 7 cut(s) 40, 79, 132, 153, 159, 168, 213
MaeI CTAG 1 cut(s) 381
MboII GAAGA 3 cut(s) 171, 313, 396
MhlI GDGCHC 2 cut(s) 39, 54
MluCI AATT 1 cut(s) 139
MlyI GAGTC 1 cut(s) 109
MslI CAYNNNNRTG 2 cut(s) 195, 374
MspR9I CCNGG 1 cut(s) 147
Mva1269I GAATGC 1 cut(s) 246
MvaI CCWGG 1 cut(s) 147
MwoI GCNNNNNNNGC 2 cut(s) 173, 277
NlaIII CATG 2 cut(s) 84, 194
NlaIV GGNNCC 1 cut(s) 64
NspI RCATGY 1 cut(s) 194
PctI GAATGC 1 cut(s) 246
PfoI TCCNGGA 1 cut(s) 145
PleI GAGTC 1 cut(s) 108
PpsI GAGTC 1 cut(s) 108
PpuMI RGGWCCY 1 cut(s) 62
Psp5II RGGWCCY 1 cut(s) 62
Psp6I CCWGG 1 cut(s) 145
PspFI CCCAGC 1 cut(s) 167
PspGI CCWGG 1 cut(s) 145
PspN4I GGNNCC 1 cut(s) 64
PspPI GGNCC 1 cut(s) 62
PspPPI RGGWCCY 1 cut(s) 62
RseI CAYNNNNRTG 2 cut(s) 195, 374
Sau96I GGNCC 1 cut(s) 62
SchI GAGTC 1 cut(s) 109
ScrFI CCNGG 1 cut(s) 147
SduI GDGCHC 2 cut(s) 39, 54
SetI ASST 2 cut(s) 226, 232
SinI GGWCC 1 cut(s) 62
SmiMI CAYNNNNRTG 2 cut(s) 195, 374
SmlI CTYRAG 2 cut(s) 38, 353
SmoI CTYRAG 2 cut(s) 38, 353
Sse9I AATT 1 cut(s) 139
SspMI CTAG 1 cut(s) 381
StyD4I CCNGG 1 cut(s) 145
TasI AATT 1 cut(s) 139
TscAI CASTG 1 cut(s) 34
TspRI CASTG 1 cut(s) 34
VneI GTGCAC 1 cut(s) 50
VpaK11BI GGWCC 1 cut(s) 62
XapI RAATTY 1 cut(s) 139
XceI RCATGY 1 cut(s) 194
XspI CTAG 1 cut(s) 381
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.