Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009890.1

Orthogroup ID

OG0017031

Physical Location & Seq

Genomic Coordinates Reverse (-)

1857 .. 3249

Gene Structure 1393 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009890.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 232 bp

gtttgctccatcccctgatccatcactaagtatcgagttttatgatcaaactctagagcaacaatcagtcctagggtatgctcatgatgtagcatcaacaaatccaattggtcctgaccaggagcacagagtacctcatggttccattggtgcagcagctggtcatcaagccattgctcagagtaatgttgaggaaatttctgaagctttggttcaatactctgcaccatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000086 GO:0000278 GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0006950 GO:0007049 GO:0007154 GO:0008150 GO:0009267 GO:0009605 GO:0009743 GO:0009746 GO:0009749 GO:0009987 GO:0009991 GO:0010033 GO:0022402 GO:0031667 GO:0031668 GO:0031669 GO:0033554 GO:0034284 GO:0042221 GO:0042594 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0044770 GO:0044772 GO:0044839 GO:0050896 GO:0051716 GO:0061770 GO:0071496 GO:1901700 GO:1903047

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-ZPR1

Protein Analysis

76

Amino Acids

8.04

Weight (kDa)

4.3

Isoelectric Point (pI)

62.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017031)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000023029
rosa_multiflora	Rmu_sc0002927.1_g000029 Rmu_sc0007339.1_g000003 Rmu_sc0009890.1_g000001 Rmu_sc0027862.1_g000001 Rmu_ssc0000155.1_g000001
rosa_roxburghii	Rroxscaffold_1G00058330
rosa_rugosa	Rorug05G0246100
rosa_samantha	Rh1AG088400 Rh3DG266000 Rh5CG151200 Rh5CG155200 Rh7CG392900 Rh7DG427800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	12
AcsI	RAATTY	1 cut(s)	196
AcuI	CTGAAG	1 cut(s)	223
AfaI	GTAC	1 cut(s)	133
AgsI	TTSAA	1 cut(s)	216
AjnI	CCWGG	1 cut(s)	118
AluBI	AGCT	2 cut(s)	159, 207
AluI	AGCT	2 cut(s)	159, 207
Alw21I	GWGCWC	1 cut(s)	127
AlwI	GGATC	1 cut(s)	12
AlwNI	CAGNNNCTG	1 cut(s)	159
ApeKI	GCWGC	2 cut(s)	153, 156
ApoI	RAATTY	1 cut(s)	196
AspA2I	CCTAGG	1 cut(s)	71
AspS9I	GGNCC	1 cut(s)	111
AvaII	GGWCC	1 cut(s)	111
AvrII	CCTAGG	1 cut(s)	71
Bbv12I	GWGCWC	1 cut(s)	127
BbvI	GCAGC	2 cut(s)	165, 168
BccI	CCATC	2 cut(s)	17, 29
BciT130I	CCWGG	1 cut(s)	120
BclI	TGATCA	1 cut(s)	44
BfaI	CTAG	2 cut(s)	54, 72
BisI	GCNGC	2 cut(s)	154, 157
BlnI	CCTAGG	1 cut(s)	71
BlsI	GCNGC	2 cut(s)	155, 158
Bme1390I	CCNGG	1 cut(s)	120
Bme18I	GGWCC	1 cut(s)	111
BmgT120I	GGNCC	1 cut(s)	111
BmiI	GGNNCC	1 cut(s)	143
BmrFI	CCNGG	1 cut(s)	120
BmsI	GCATC	1 cut(s)	102
BsaJI	CCNNGG	1 cut(s)	71
Bse3DI	GCAATG	1 cut(s)	172
BseBI	CCWGG	1 cut(s)	120
BseDI	CCNNGG	1 cut(s)	71
BseGI	GGATG	1 cut(s)	9
BseMI	GCAATG	1 cut(s)	172
BseMII	CTCAG	1 cut(s)	192
BseXI	GCAGC	2 cut(s)	165, 168
BsgI	GTGCAG	2 cut(s)	172, 208
BsiHKAI	GWGCWC	1 cut(s)	127
Bsp1286I	GDGCHC	1 cut(s)	127
Bsp143I	GATC	2 cut(s)	17, 44
BspCNI	CTCAG	1 cut(s)	191
BspHI	TCATGA	1 cut(s)	83
BspLI	GGNNCC	1 cut(s)	143
BspPI	GGATC	1 cut(s)	12
BsrDI	GCAATG	1 cut(s)	172
BssECI	CCNNGG	1 cut(s)	71
BssMI	GATC	2 cut(s)	17, 44
BssT1I	CCWWGG	1 cut(s)	71
Bst2UI	CCWGG	1 cut(s)	120
BstDEI	CTNAG	2 cut(s)	27, 178
BstF5I	GGATG	1 cut(s)	9
BstKTI	GATC	2 cut(s)	20, 47
BstMBI	GATC	2 cut(s)	17, 44
BstNI	CCWGG	1 cut(s)	120
BstSCI	CCNGG	1 cut(s)	118
BstV1I	GCAGC	2 cut(s)	165, 168
BtsCI	GGATG	1 cut(s)	9
CaiI	CAGNNNCTG	1 cut(s)	159
CciI	TCATGA	1 cut(s)	83
Cfr13I	GGNCC	1 cut(s)	111
Csp6I	GTAC	1 cut(s)	132
CviAII	CATG	2 cut(s)	84, 138
CviJI	RGCY	3 cut(s)	159, 171, 207
CviKI_1	RGCY	3 cut(s)	159, 171, 207
CviQI	GTAC	1 cut(s)	132
DdeI	CTNAG	2 cut(s)	27, 178
DpnI	GATC	2 cut(s)	19, 46
DpnII	GATC	2 cut(s)	17, 44
Eco130I	CCWWGG	1 cut(s)	71
Eco47I	GGWCC	1 cut(s)	111
Eco57I	CTGAAG	1 cut(s)	223
EcoRII	CCWGG	1 cut(s)	118
EcoT14I	CCWWGG	1 cut(s)	71
ErhI	CCWWGG	1 cut(s)	71
FaeI	CATG	2 cut(s)	87, 141
FaiI	YATR	5 cut(s)	43, 79, 85, 139, 230
FatI	CATG	2 cut(s)	83, 137
FbaI	TGATCA	1 cut(s)	44
Fnu4HI	GCNGC	2 cut(s)	154, 157
Fsp4HI	GCNGC	2 cut(s)	154, 157
FspBI	CTAG	2 cut(s)	54, 72
GluI	GCNGC	2 cut(s)	154, 157
Hin1II	CATG	2 cut(s)	87, 141
HindIII	AAGCTT	1 cut(s)	205
Hpy188I	TCNGA	2 cut(s)	181, 203
Hpy188III	TCNNGA	3 cut(s)	54, 84, 114
HpyCH4V	TGCA	2 cut(s)	153, 225
HpyF3I	CTNAG	2 cut(s)	27, 178
Hsp92II	CATG	2 cut(s)	87, 141
Ksp22I	TGATCA	1 cut(s)	44
Kzo9I	GATC	2 cut(s)	17, 44
LmnI	GCTCC	2 cut(s)	11, 122
LpnPI	CCDG	5 cut(s)	28, 105, 127, 132, 145
Lsp1109I	GCAGC	2 cut(s)	165, 168
LweI	GCATC	1 cut(s)	102
MaeI	CTAG	2 cut(s)	54, 72
MalI	GATC	2 cut(s)	19, 46
MboI	GATC	2 cut(s)	17, 44
MfeI	CAATTG	1 cut(s)	106
MhlI	GDGCHC	1 cut(s)	127
MluCI	AATT	2 cut(s)	106, 196
MnlI	CCTC	2 cut(s)	145, 185
MspA1I	CMGCKG	1 cut(s)	159
MspR9I	CCNGG	1 cut(s)	120
MunI	CAATTG	1 cut(s)	106
MvaI	CCWGG	1 cut(s)	120
NdeII	GATC	2 cut(s)	17, 44
NlaIII	CATG	2 cut(s)	87, 141
NlaIV	GGNNCC	1 cut(s)	143
PagI	TCATGA	1 cut(s)	83
PkrI	GCNGC	2 cut(s)	155, 158
Psp6I	CCWGG	1 cut(s)	118
PspGI	CCWGG	1 cut(s)	118
PspN4I	GGNNCC	1 cut(s)	143
PspPI	GGNCC	1 cut(s)	111
PstNI	CAGNNNCTG	1 cut(s)	159
PvuII	CAGCTG	1 cut(s)	159
RsaI	GTAC	1 cut(s)	133
RsaNI	GTAC	1 cut(s)	132
SatI	GCNGC	2 cut(s)	154, 157
Sau3AI	GATC	2 cut(s)	17, 44
Sau96I	GGNCC	1 cut(s)	111
ScrFI	CCNGG	1 cut(s)	120
SduI	GDGCHC	1 cut(s)	127
SetI	ASST	3 cut(s)	137, 161, 209
SfaNI	GCATC	1 cut(s)	102
SinI	GGWCC	1 cut(s)	111
Sse9I	AATT	2 cut(s)	106, 196
SspMI	CTAG	2 cut(s)	54, 72
StyD4I	CCNGG	1 cut(s)	118
StyI	CCWWGG	1 cut(s)	71
TaqI	TCGA	1 cut(s)	34
TasI	AATT	2 cut(s)	106, 196
TseI	GCWGC	2 cut(s)	153, 156
VpaK11BI	GGWCC	1 cut(s)	111
XapI	RAATTY	1 cut(s)	196
XbaI	TCTAGA	1 cut(s)	53
XmaJI	CCTAGG	1 cut(s)	71
XspI	CTAG	2 cut(s)	54, 72

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.