Rroxscaffold_1G00058330

exocyst complex component

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
80173073 .. 80176603
3531 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00058330.1

Sequence Viewer

Length: 183 bp
ATGCGCTCAGAACTGGAGCCTGGAGTCTCAAGTCTCAAGTCTGAAGAGAGCAAAGCTAAAGCAGTCGTAAAATGGAGAGTAGTGAAGGAGAAGAGGTTTCCTATCATTAAAGGCATCACTCCCCAGTCCAAAGTTGACTCTCTTTACCAATCCCACACTGAAAAGGTCTGCTCCATCCCCTGA

Protein Analysis

60

Amino Acids

6.77

Weight (kDa)

9.67

Isoelectric Point (pI)

56.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 63
AjnI CCWGG 1 cut(s) 19
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
Alw26I GTCTC 2 cut(s) 31, 38
AspLEI GCGC 1 cut(s) 6
BccI CCATC 1 cut(s) 182
BciT130I CCWGG 1 cut(s) 21
BcoDI GTCTC 2 cut(s) 31, 38
Bme1390I CCNGG 1 cut(s) 21
BmiI GGNNCC 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 21
BmrI ACTGGG 1 cut(s) 118
BmsI GCATC 1 cut(s) 123
BmuI ACTGGG 1 cut(s) 118
BpmI CTGGAG 2 cut(s) 35, 42
BpuEI CTTGAG 2 cut(s) 13, 20
BsaXI ACNNNNNCTCC 2 cut(s) 80, 110
Bse1I ACTGG 2 cut(s) 18, 124
BseBI CCWGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 174
BseMII CTCAG 1 cut(s) 21
BseNI ACTGG 2 cut(s) 18, 124
BsmAI GTCTC 2 cut(s) 31, 38
BspCNI CTCAG 1 cut(s) 20
BspLI GGNNCC 1 cut(s) 18
BsrI ACTGG 2 cut(s) 18, 124
Bst2UI CCWGG 1 cut(s) 21
Bst6I CTCTTC 2 cut(s) 39, 86
BstDEI CTNAG 1 cut(s) 7
BstF5I GGATG 1 cut(s) 174
BstHHI GCGC 1 cut(s) 6
BstMAI GTCTC 2 cut(s) 31, 38
BstNI CCWGG 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 19
BtsCI GGATG 1 cut(s) 174
BtsIMutI CAGTG 1 cut(s) 156
CfoI GCGC 1 cut(s) 6
CviJI RGCY 2 cut(s) 19, 56
CviKI_1 RGCY 2 cut(s) 19, 56
DdeI CTNAG 1 cut(s) 7
Eam1104I CTCTTC 2 cut(s) 39, 86
EarI CTCTTC 2 cut(s) 39, 86
Eco57I CTGAAG 1 cut(s) 63
EcoRII CCWGG 1 cut(s) 19
FokI GGATG 1 cut(s) 161
GlaI GCGC 1 cut(s) 5
GsuI CTGGAG 2 cut(s) 35, 42
HhaI GCGC 1 cut(s) 6
Hin6I GCGC 1 cut(s) 4
HinP1I GCGC 1 cut(s) 4
HincII GTYRAC 1 cut(s) 136
HindII GTYRAC 1 cut(s) 136
HinfI GANTC 2 cut(s) 24, 137
Hpy166II GTNNAC 1 cut(s) 136
Hpy188I TCNGA 2 cut(s) 10, 43
Hpy8I GTNNAC 1 cut(s) 136
HpyAV CCTTC 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 7
HspAI GCGC 1 cut(s) 4
LmnI GCTCC 2 cut(s) 16, 176
LpnPI CCDG 3 cut(s) 6, 33, 137
LweI GCATC 1 cut(s) 123
MboII GAAGA 2 cut(s) 56, 103
MlyI GAGTC 2 cut(s) 33, 131
MnlI CCTC 1 cut(s) 87
MseI TTAA 1 cut(s) 108
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
NlaIV GGNNCC 1 cut(s) 18
PleI GAGTC 2 cut(s) 32, 131
PpsI GAGTC 2 cut(s) 32, 131
Psp6I CCWGG 1 cut(s) 19
PspGI CCWGG 1 cut(s) 19
PspN4I GGNNCC 1 cut(s) 18
SaqAI TTAA 1 cut(s) 108
SchI GAGTC 2 cut(s) 33, 131
ScrFI CCNGG 1 cut(s) 21
SetI ASST 3 cut(s) 58, 98, 168
SfaNI GCATC 1 cut(s) 123
SgeI CNNG 6 cut(s) 26, 32, 33, 42, 49, 136
SmlI CTYRAG 2 cut(s) 28, 35
SmoI CTYRAG 2 cut(s) 28, 35
StyD4I CCNGG 1 cut(s) 19
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TscAI CASTG 1 cut(s) 163
TspRI CASTG 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.