Rmu_sc0010439.1_g000010

Glycosyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010439.1
OG0014831
Physical Location & Seq
Forward (+)
42618 .. 43823
1206 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010439.1_g000010.1.cds

Sequence Viewer

Length: 390 bp
atgggtgttgctgctctaacccagagactatgcaactttgaaatccagagactggtgttgataatcggtgtggcgattgttattgtagttgtgaatcagtgttttgagcttccctttggtaaaaatgtttacttttcacctgctgatactggttcagctttagtggtcacattgttaggtaatgttactagttcaaatgattcggagtctgggaagtttgatgttgttggtgtagtggggatagtggttaatgatactggtggtttagagttagaggagtttgagttagagaaagatgcaaccggtgaccggattctggcgaaaattggccggattccggcgaccgctcaccggaatccggcgaagttggccggaattggctgccggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Exostosin

Protein Analysis

129

Amino Acids

13.61

Weight (kDa)

5.07

Isoelectric Point (pI)

15.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 148
Acc36I ACCTGC 1 cut(s) 148
AccB7I CCANNNNNTGG 1 cut(s) 52
AccBSI CCGCTC 1 cut(s) 347
AciI CCGC 1 cut(s) 345
AcoI YGGCCR 2 cut(s) 328, 369
AfiI CCNNNNNNNGG 6 cut(s) 52, 309, 316, 337, 351, 358
AgeI ACCGGT 1 cut(s) 302
AgsI TTSAA 2 cut(s) 41, 195
AhlI ACTAGT 1 cut(s) 188
AluBI AGCT 2 cut(s) 109, 158
AluI AGCT 2 cut(s) 109, 158
Alw26I GTCTC 2 cut(s) 19, 43
AlwNI CAGNNNCTG 1 cut(s) 52
AoxI GGCC 2 cut(s) 328, 369
ApeKI GCWGC 2 cut(s) 11, 381
AsiGI ACCGGT 1 cut(s) 302
AsuHPI GGTGA 3 cut(s) 129, 317, 341
BbvI GCAGC 1 cut(s) 368
BcoDI GTCTC 2 cut(s) 19, 43
BcuI ACTAGT 1 cut(s) 188
BfaI CTAG 1 cut(s) 189
BfuAI ACCTGC 1 cut(s) 148
BisI GCNGC 2 cut(s) 12, 382
BlsI GCNGC 2 cut(s) 13, 383
BmsI GCATC 1 cut(s) 286
BsaWI WCCGGW 3 cut(s) 302, 309, 351
BsaXI ACNNNNNCTCC 2 cut(s) 269, 299
Bsc4I CCNNNNNNNGG 6 cut(s) 52, 309, 316, 337, 351, 358
Bse118I RCCGGY 2 cut(s) 302, 384
Bse1I ACTGG 3 cut(s) 57, 154, 262
BseLI CCNNNNNNNGG 6 cut(s) 52, 309, 316, 337, 351, 358
BseNI ACTGG 3 cut(s) 57, 154, 262
BseRI GAGGAG 1 cut(s) 290
BseXI GCAGC 1 cut(s) 368
Bsh1285I CGRYCG 1 cut(s) 345
BshFI GGCC 2 cut(s) 330, 371
BshTI ACCGGT 1 cut(s) 302
BsiEI CGRYCG 1 cut(s) 345
BsiSI CCGG 8 cut(s) 303, 310, 331, 338, 352, 359, 372, 385
BslI CCNNNNNNNGG 6 cut(s) 52, 309, 316, 337, 351, 358
BsmAI GTCTC 2 cut(s) 19, 43
BsnI GGCC 2 cut(s) 330, 371
BspACI CCGC 1 cut(s) 345
BspANI GGCC 2 cut(s) 330, 371
BspMI ACCTGC 1 cut(s) 148
BsrBI CCGCTC 1 cut(s) 347
BsrFI RCCGGY 2 cut(s) 302, 384
BsrI ACTGG 3 cut(s) 57, 154, 262
BssAI RCCGGY 2 cut(s) 302, 384
BstEII GGTNACC 1 cut(s) 305
BstMAI GTCTC 2 cut(s) 19, 43
BstMCI CGRYCG 1 cut(s) 345
BstMWI GCNNNNNNNGC 1 cut(s) 368
BstPI GGTNACC 1 cut(s) 305
BstV1I GCAGC 1 cut(s) 368
BsuRI GGCC 2 cut(s) 330, 371
BtsIMutI CAGTG 1 cut(s) 104
BveI ACCTGC 1 cut(s) 148
CaiI CAGNNNCTG 1 cut(s) 52
Cfr10I RCCGGY 2 cut(s) 302, 384
CspAI ACCGGT 1 cut(s) 302
CviJI RGCY 5 cut(s) 109, 158, 330, 371, 381
CviKI_1 RGCY 5 cut(s) 109, 158, 330, 371, 381
EaeI YGGCCR 2 cut(s) 328, 369
Eco91I GGTNACC 1 cut(s) 305
EcoO65I GGTNACC 1 cut(s) 305
FaiI YATR 1 cut(s) 31
Fnu4HI GCNGC 2 cut(s) 12, 382
Fsp4HI GCNGC 2 cut(s) 12, 382
FspBI CTAG 1 cut(s) 189
GluI GCNGC 2 cut(s) 12, 382
HaeIII GGCC 2 cut(s) 330, 371
HapII CCGG 8 cut(s) 303, 310, 331, 338, 352, 359, 372, 385
HinfI GANTC 6 cut(s) 94, 200, 206, 313, 334, 355
HpaII CCGG 8 cut(s) 303, 310, 331, 338, 352, 359, 372, 385
HphI GGTGA 3 cut(s) 129, 317, 341
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 46
Hpy8I GTNNAC 1 cut(s) 130
HpyCH4V TGCA 2 cut(s) 33, 299
HpyF10VI GCNNNNNNNGC 1 cut(s) 368
Lsp1109I GCAGC 1 cut(s) 368
LweI GCATC 1 cut(s) 286
MaeI CTAG 1 cut(s) 189
MaeIII GTNAC 3 cut(s) 166, 184, 305
MbiI CCGCTC 1 cut(s) 347
MluCI AATT 2 cut(s) 324, 375
MlyI GAGTC 1 cut(s) 215
MnlI CCTC 1 cut(s) 268
MseI TTAA 1 cut(s) 249
MspI CCGG 8 cut(s) 303, 310, 331, 338, 352, 359, 372, 385
MwoI GCNNNNNNNGC 1 cut(s) 368
NmuCI GTSAC 2 cut(s) 166, 305
PaqCI CACCTGC 1 cut(s) 148
PfeI GAWTC 5 cut(s) 94, 200, 313, 334, 355
PflMI CCANNNNNTGG 1 cut(s) 52
PinAI ACCGGT 1 cut(s) 302
PkrI GCNGC 2 cut(s) 13, 383
PleI GAGTC 1 cut(s) 214
PpsI GAGTC 1 cut(s) 214
PspEI GGTNACC 1 cut(s) 305
PstNI CAGNNNCTG 1 cut(s) 52
SaqAI TTAA 1 cut(s) 249
SatI GCNGC 2 cut(s) 12, 382
SchI GAGTC 1 cut(s) 215
SetI ASST 4 cut(s) 111, 142, 160, 181
SfaNI GCATC 1 cut(s) 286
SpeI ACTAGT 1 cut(s) 188
Sse9I AATT 2 cut(s) 324, 375
SsiI CCGC 1 cut(s) 345
SspMI CTAG 1 cut(s) 189
TasI AATT 2 cut(s) 324, 375
TfiI GAWTC 5 cut(s) 94, 200, 313, 334, 355
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TscAI CASTG 1 cut(s) 104
TseFI GTSAC 2 cut(s) 166, 305
TseI GCWGC 2 cut(s) 11, 381
Tsp45I GTSAC 2 cut(s) 166, 305
TspRI CASTG 1 cut(s) 104
Van91I CCANNNNNTGG 1 cut(s) 52
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.