Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012033.1

Orthogroup ID

OG0011407

Physical Location & Seq

Genomic Coordinates Reverse (-)

5831 .. 8190

Gene Structure 2360 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012033.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 627 bp

atggcagagcttcagaaagagatagataagtacagagactttttggtgattgacatcaaggatgaatatgtaagccttccatggaaaacgttggagtttttcaaggtggcgtttcaacagtttgaagcagattattatgtcaaagctgatgatgatatttatctacgcccagatcgactagcaacacttttagctaaggagagaacagattcacgaacctacattggttgcatgaagaaaggtccagtgataactgacccaaaaatgaaatggtatgagaaatcaggacatctgattgggaatgaatactttcaacatgcctatgctcctatttatggtctatctgcggaggtggttgtgtcattggcaactgctaaaaataacagtttgagaatgtttaacaatgaagatgtcacaattggatcatggatgcttgccatgaatgtccatcatgaggataatcgttttttatgtgaccctcggtgctcacctagatccattgcagtgtgggacatcccgaaatgttcaggtttatgcaatccagctattcggatgaaagagcttcatgcaatgagtatgtgctccaaaagtccaaccctgctccctactgatgctgatgacagatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0012505 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00532 ko00534 ko01100 map00532 map00534 map01100

Pfam Domains

Protein Families

Galactosyl_T

Protein Analysis

208

Amino Acids

24.0

Weight (kDa)

5.97

Isoelectric Point (pI)

31.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011407)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G26100 AT2G26100
fragaria_vesca	FvH4_2g31860 FvH4_2g31860
malus_domestica	MD08G1061800.v1.1 MD15G1059900.v1.1
prunus_persica	Prupe.1G411800_v2.0.a1
pyrus_communis	pycom08g05130 pycom15g05620
rosa_chinensis	RchiOBHm_Chr6g0310931
rosa_laevigata	RLG00000010449
rosa_multiflora	Rmu_sc0012033.1_g000001
rosa_roxburghii	Rroxscaffold_7G00158160
rosa_rugosa	Rorug06G0384100 Rorug06G0384200
rosa_samantha	Rh6AG498000 Rh6BG508400 Rh6CG514300 Rh6DG500800
rosa_wichuraiana	Rw6G043370

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	347
AclI	AACGTT	1 cut(s)	89
AclWI	GGATC	2 cut(s)	430, 489
AfaI	GTAC	1 cut(s)	32
AfiI	CCNNNNNNNGG	2 cut(s)	335, 454
AgsI	TTSAA	4 cut(s)	103, 116, 125, 314
AluBI	AGCT	5 cut(s)	10, 146, 194, 545, 562
AluI	AGCT	5 cut(s)	10, 146, 194, 545, 562
Alw21I	GWGCWC	2 cut(s)	488, 584
Alw26I	GTCTC	1 cut(s)	30
AlwI	GGATC	2 cut(s)	430, 489
Asp700I	GAANNNNTTC	2 cut(s)	208, 309
AspS9I	GGNCC	1 cut(s)	242
AsuHPI	GGTGA	2 cut(s)	58, 480
AvaII	GGWCC	1 cut(s)	242
Bbv12I	GWGCWC	2 cut(s)	488, 584
BccI	CCATC	1 cut(s)	456
BcoDI	GTCTC	1 cut(s)	30
BfaI	CTAG	2 cut(s)	179, 492
Bme18I	GGWCC	1 cut(s)	242
BmgT120I	GGNCC	1 cut(s)	242
BmsI	GCATC	2 cut(s)	420, 601
Bpu10I	CCTNAGC	1 cut(s)	195
BsaBI	GATNNNNATC	2 cut(s)	53, 159
BsaJI	CCNNGG	2 cut(s)	80, 479
Bsc4I	CCNNNNNNNGG	2 cut(s)	335, 454
Bse1I	ACTGG	1 cut(s)	245
Bse3DI	GCAATG	2 cut(s)	498, 576
Bse8I	GATNNNNATC	2 cut(s)	53, 159
BseDI	CCNNGG	2 cut(s)	80, 479
BseGI	GGATG	4 cut(s)	67, 435, 513, 558
BseJI	GATNNNNATC	2 cut(s)	53, 159
BseLI	CCNNNNNNNGG	2 cut(s)	335, 454
BseMI	GCAATG	2 cut(s)	498, 576
BseNI	ACTGG	1 cut(s)	245
BsiHKAI	GWGCWC	2 cut(s)	488, 584
BslFI	GGGAC	1 cut(s)	524
BslI	CCNNNNNNNGG	2 cut(s)	335, 454
BsmAI	GTCTC	1 cut(s)	30
BsmFI	GGGAC	1 cut(s)	524
Bsp1286I	GDGCHC	2 cut(s)	488, 584
Bsp143I	GATC	3 cut(s)	172, 422, 494
Bsp19I	CCATGG	1 cut(s)	80
BspACI	CCGC	1 cut(s)	347
BspHI	TCATGA	1 cut(s)	451
BspPI	GGATC	2 cut(s)	430, 489
BsrDI	GCAATG	2 cut(s)	498, 576
BsrI	ACTGG	1 cut(s)	245
BssECI	CCNNGG	2 cut(s)	80, 479
BssMI	GATC	3 cut(s)	172, 422, 494
BssT1I	CCWWGG	1 cut(s)	80
Bst4CI	ACNGT	2 cut(s)	120, 386
BstC8I	GCNNGC	1 cut(s)	435
BstDEI	CTNAG	1 cut(s)	195
BstDSI	CCRYGG	1 cut(s)	80
BstF5I	GGATG	4 cut(s)	67, 435, 513, 558
BstKTI	GATC	3 cut(s)	175, 425, 497
BstMAI	GTCTC	1 cut(s)	30
BstMBI	GATC	3 cut(s)	172, 422, 494
BstNSI	RCATGY	1 cut(s)	320
BstX2I	RGATCY	1 cut(s)	494
BstYI	RGATCY	1 cut(s)	494
BtgI	CCRYGG	1 cut(s)	80
BtsCI	GGATG	4 cut(s)	67, 435, 513, 558
BtsI	GCAGTG	1 cut(s)	510
BtsIMutI	CAGTG	2 cut(s)	252, 510
Cac8I	GCNNGC	1 cut(s)	435
CciI	TCATGA	1 cut(s)	451
Cfr13I	GGNCC	1 cut(s)	242
Csp6I	GTAC	1 cut(s)	31
CviAII	CATG	7 cut(s)	81, 232, 317, 426, 439, 452, 566
CviJI	RGCY	6 cut(s)	10, 75, 146, 194, 545, 562
CviKI_1	RGCY	6 cut(s)	10, 75, 146, 194, 545, 562
CviQI	GTAC	1 cut(s)	31
DdeI	CTNAG	1 cut(s)	195
DpnI	GATC	3 cut(s)	174, 424, 496
DpnII	GATC	3 cut(s)	172, 422, 494
Eco130I	CCWWGG	1 cut(s)	80
Eco47I	GGWCC	1 cut(s)	242
EcoT14I	CCWWGG	1 cut(s)	80
ErhI	CCWWGG	1 cut(s)	80
FaeI	CATG	7 cut(s)	84, 235, 320, 429, 442, 455, 569
FaqI	GGGAC	1 cut(s)	524
FatI	CATG	7 cut(s)	80, 231, 316, 425, 438, 451, 565
FokI	GGATG	4 cut(s)	74, 442, 500, 565
FspBI	CTAG	2 cut(s)	179, 492
Hin1II	CATG	7 cut(s)	84, 235, 320, 429, 442, 455, 569
HinfI	GANTC	1 cut(s)	209
HphI	GGTGA	2 cut(s)	58, 480
Hpy188I	TCNGA	3 cut(s)	15, 294, 552
Hpy188III	TCNNGA	4 cut(s)	213, 285, 452, 517
HpyAV	CCTTC	1 cut(s)	86
HpyCH4III	ACNGT	2 cut(s)	120, 386
HpyCH4IV	ACGT	1 cut(s)	89
HpyCH4V	TGCA	4 cut(s)	231, 503, 537, 569
HpyF3I	CTNAG	1 cut(s)	195
HpySE526I	ACGT	1 cut(s)	89
Hsp92II	CATG	7 cut(s)	84, 235, 320, 429, 442, 455, 569
Kzo9I	GATC	3 cut(s)	172, 422, 494
LmnI	GCTCC	3 cut(s)	331, 587, 606
LpnPI	CCDG	6 cut(s)	183, 258, 270, 513, 555, 611
LweI	GCATC	2 cut(s)	420, 601
MaeI	CTAG	2 cut(s)	179, 492
MaeII	ACGT	1 cut(s)	89
MaeIII	GTNAC	2 cut(s)	412, 473
MalI	GATC	3 cut(s)	174, 424, 496
MboI	GATC	3 cut(s)	172, 422, 494
MboII	GAAGA	2 cut(s)	247, 419
MfeI	CAATTG	1 cut(s)	417
MflI	RGATCY	1 cut(s)	494
MhlI	GDGCHC	2 cut(s)	488, 584
MluCI	AATT	1 cut(s)	417
MmeI	TCCRAC	2 cut(s)	72, 617
MnlI	CCTC	3 cut(s)	343, 448, 489
MroXI	GAANNNNTTC	2 cut(s)	208, 309
MseI	TTAA	1 cut(s)	399
MslI	CAYNNNNRTG	2 cut(s)	321, 503
MunI	CAATTG	1 cut(s)	417
NcoI	CCATGG	1 cut(s)	80
NdeII	GATC	3 cut(s)	172, 422, 494
NlaIII	CATG	7 cut(s)	84, 235, 320, 429, 442, 455, 569
NmuCI	GTSAC	2 cut(s)	412, 473
NspI	RCATGY	1 cut(s)	320
PagI	TCATGA	1 cut(s)	451
PcsI	WCGNNNNNNNCGW	1 cut(s)	172
PdmI	GAANNNNTTC	2 cut(s)	208, 309
PfeI	GAWTC	1 cut(s)	209
Psp1406I	AACGTT	1 cut(s)	89
PspPI	GGNCC	1 cut(s)	242
PsuI	RGATCY	1 cut(s)	494
RsaI	GTAC	1 cut(s)	32
RsaNI	GTAC	1 cut(s)	31
RseI	CAYNNNNRTG	2 cut(s)	321, 503
SaqAI	TTAA	1 cut(s)	399
Sau3AI	GATC	3 cut(s)	172, 422, 494
Sau96I	GGNCC	1 cut(s)	242
SduI	GDGCHC	2 cut(s)	488, 584
SfaNI	GCATC	2 cut(s)	420, 601
SinI	GGWCC	1 cut(s)	242
SmiMI	CAYNNNNRTG	2 cut(s)	321, 503
Sse9I	AATT	1 cut(s)	417
SsiI	CCGC	1 cut(s)	347
SspMI	CTAG	2 cut(s)	179, 492
StyI	CCWWGG	1 cut(s)	80
TaaI	ACNGT	2 cut(s)	120, 386
TaiI	ACGT	1 cut(s)	92
TaqI	TCGA	1 cut(s)	175
TasI	AATT	1 cut(s)	417
TatI	WGTACW	1 cut(s)	30
TfiI	GAWTC	1 cut(s)	209
Tru1I	TTAA	1 cut(s)	399
Tru9I	TTAA	1 cut(s)	399
TscAI	CASTG	2 cut(s)	252, 510
TseFI	GTSAC	2 cut(s)	412, 473
Tsp45I	GTSAC	2 cut(s)	412, 473
TspDTI	ATGAA	8 cut(s)	78, 248, 281, 318, 420, 455, 554, 569
TspRI	CASTG	2 cut(s)	252, 510
VpaK11BI	GGWCC	1 cut(s)	242
XceI	RCATGY	1 cut(s)	320
XcmI	CCANNNNNNNNNTGG	1 cut(s)	267
XmnI	GAANNNNTTC	2 cut(s)	208, 309
XspI	CTAG	2 cut(s)	179, 492

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.