Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013858.1

Orthogroup ID

OG0006172

Physical Location & Seq

Genomic Coordinates Reverse (-)

1913 .. 2632

Gene Structure 720 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013858.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 720 bp

atggatatacacaaagaaagcaaggagcatgcttcgtctgaatcccttttacaatggggccaatggcaactgcttgattctatcctcccaaccggtggttttgcacattcctttggtcttgaggctgcaatccaagctcgcatagtctctggtcctgaagatctccaaacttttgtaattcatcatttagagaatactgcaagcttactccttccttttgtgtattctacaacaatatcgcctgatttggagagtttgcgtagacatgacaagatattggatgcaatgctaactaatgaagtgggtagaaaggcatcaattgcacaagggtctgcgctgatgcgagtagctgcagctgtttattcggaaataccatctcttaaatctatgagggaaacttctttgagtaatggagttgtttcttttcatcatgctcctatgtttgggcttatatgtggattgcttgggttggatagcagtacttctcaaagagctttcatgtttgtcacaatgagagatgttatttcagctgcaacaaggctgaatttggtcggaccccttggtgctgctgttctgcaacatcatattgctcctatctctgaagctatactgaatcaatggaaggaccgtcccattgaggaagcatgccaaactgttcctttacttgatattgtgcagggttgtcatagctacctgttctctagactgttctgttcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0006807 GO:0008150 GO:0008152 GO:0043085 GO:0044093 GO:0050790 GO:0051336 GO:0051345 GO:0065007 GO:0065009 GO:1905181 GO:1905182

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UreF

Protein Analysis

239

Amino Acids

26.18

Weight (kDa)

5.97

Isoelectric Point (pI)

42.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006172)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G21840 AT1G21840
fragaria_vesca	FvH4_2g00490 FvH4_2g00490
malus_domestica	MD10G1003100.v1.1
prunus_persica	Prupe.8G030900_v2.0.a1
pyrus_communis	pycom10g00250
rosa_chinensis	RchiOBHm_Chr6g0250481 RchiOBHm_Chr6g0250811
rosa_laevigata	RLG00000015537
rosa_multiflora	Rmu_sc0001209.1_g000020 Rmu_sc0001209.1_g000034 Rmu_sc0013858.1_g000001
rosa_roxburghii	Rroxscaffold_7G00217200
rosa_rugosa	Rorug05G0497500 Rorug05G0497600 Rorug05G0497700
rosa_samantha	Rh1BG033200 Rh1DG034100 Rh6AG006200 Rh6BG004400 Rh6CG004400 Rh6DG004300
rosa_wichuraiana	Rw1G004580 Rw1G004640 Rw6G000670 Rw6G000740

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	95
AccI	GTMKAC	1 cut(s)	262
AcsI	RAATTY	1 cut(s)	544
AcuI	CTGAAG	2 cut(s)	177, 621
AfaI	GTAC	1 cut(s)	481
AfiI	CCNNNNNNNGG	2 cut(s)	95, 443
AgeI	ACCGGT	1 cut(s)	92
AluBI	AGCT	8 cut(s)	137, 204, 350, 356, 494, 530, 605, 690
AluI	AGCT	8 cut(s)	137, 204, 350, 356, 494, 530, 605, 690
Alw26I	GTCTC	1 cut(s)	151
AoxI	GGCC	1 cut(s)	58
ApeKI	GCWGC	5 cut(s)	125, 350, 353, 530, 566
ApoI	RAATTY	1 cut(s)	544
AsiGI	ACCGGT	1 cut(s)	92
AspLEI	GCGC	1 cut(s)	337
AspS9I	GGNCC	4 cut(s)	58, 152, 554, 625
AvaII	GGWCC	3 cut(s)	152, 554, 625
BbvI	GCAGC	5 cut(s)	112, 337, 365, 517, 553
BccI	CCATC	1 cut(s)	382
BcoDI	GTCTC	1 cut(s)	151
BfaI	CTAG	1 cut(s)	702
BfmI	CTRYAG	1 cut(s)	351
BglII	AGATCT	1 cut(s)	160
BisI	GCNGC	5 cut(s)	126, 351, 354, 531, 567
BlsI	GCNGC	5 cut(s)	127, 352, 355, 532, 568
BmcAI	AGTACT	1 cut(s)	481
Bme18I	GGWCC	3 cut(s)	152, 554, 625
BmgT120I	GGNCC	4 cut(s)	58, 152, 554, 625
BmiI	GGNNCC	2 cut(s)	59, 556
BmsI	GCATC	3 cut(s)	271, 323, 330
BpuEI	CTTGAG	1 cut(s)	140
BsaJI	CCNNGG	1 cut(s)	559
BsaWI	WCCGGW	1 cut(s)	92
Bsc4I	CCNNNNNNNGG	2 cut(s)	95, 443
Bse118I	RCCGGY	1 cut(s)	92
Bse3DI	GCAATG	1 cut(s)	291
BseDI	CCNNGG	1 cut(s)	559
BseGI	GGATG	1 cut(s)	286
BseLI	CCNNNNNNNGG	2 cut(s)	95, 443
BseMI	GCAATG	1 cut(s)	291
BseXI	GCAGC	5 cut(s)	112, 337, 365, 517, 553
BsgI	GTGCAG	1 cut(s)	695
BshFI	GGCC	1 cut(s)	60
BshTI	ACCGGT	1 cut(s)	92
BsiSI	CCGG	1 cut(s)	93
BslFI	GGGAC	1 cut(s)	615
BslI	CCNNNNNNNGG	2 cut(s)	95, 443
BsmAI	GTCTC	1 cut(s)	151
BsmFI	GGGAC	1 cut(s)	615
BsnI	GGCC	1 cut(s)	60
Bsp143I	GATC	1 cut(s)	160
BspANI	GGCC	1 cut(s)	60
BspLI	GGNNCC	2 cut(s)	59, 556
BspMAI	CTGCAG	1 cut(s)	355
BsrDI	GCAATG	1 cut(s)	291
BsrFI	RCCGGY	1 cut(s)	92
BssAI	RCCGGY	1 cut(s)	92
BssECI	CCNNGG	1 cut(s)	559
BssMI	GATC	1 cut(s)	160
BssT1I	CCWWGG	1 cut(s)	559
Bst4CI	ACNGT	3 cut(s)	629, 655, 708
BstAPI	GCANNNNNTGC	1 cut(s)	320
BstC8I	GCNNGC	4 cut(s)	30, 139, 202, 646
BstF5I	GGATG	1 cut(s)	286
BstHHI	GCGC	1 cut(s)	337
BstKTI	GATC	1 cut(s)	163
BstMAI	GTCTC	1 cut(s)	151
BstMBI	GATC	1 cut(s)	160
BstMWI	GCNNNNNNNGC	2 cut(s)	134, 320
BstNSI	RCATGY	2 cut(s)	32, 648
BstSFI	CTRYAG	1 cut(s)	351
BstV1I	GCAGC	5 cut(s)	112, 337, 365, 517, 553
BstX2I	RGATCY	1 cut(s)	160
BstYI	RGATCY	1 cut(s)	160
BsuRI	GGCC	1 cut(s)	60
BtsCI	GGATG	1 cut(s)	286
Cac8I	GCNNGC	4 cut(s)	30, 139, 202, 646
CfoI	GCGC	1 cut(s)	337
Cfr10I	RCCGGY	1 cut(s)	92
Cfr13I	GGNCC	4 cut(s)	58, 152, 554, 625
Csp6I	GTAC	1 cut(s)	480
CspAI	ACCGGT	1 cut(s)	92
CviAII	CATG	5 cut(s)	29, 266, 431, 499, 645
CviQI	GTAC	1 cut(s)	480
DpnI	GATC	1 cut(s)	162
DpnII	GATC	1 cut(s)	160
Eco130I	CCWWGG	1 cut(s)	559
Eco47I	GGWCC	3 cut(s)	152, 554, 625
Eco57I	CTGAAG	2 cut(s)	177, 621
EcoT14I	CCWWGG	1 cut(s)	559
ErhI	CCWWGG	1 cut(s)	559
FaeI	CATG	5 cut(s)	32, 269, 434, 502, 648
FaqI	GGGAC	1 cut(s)	615
FatI	CATG	5 cut(s)	28, 265, 430, 498, 644
FblI	GTMKAC	1 cut(s)	262
Fnu4HI	GCNGC	5 cut(s)	126, 351, 354, 531, 567
FokI	GGATG	1 cut(s)	293
Fsp4HI	GCNGC	5 cut(s)	126, 351, 354, 531, 567
FspBI	CTAG	1 cut(s)	702
GlaI	GCGC	1 cut(s)	336
GluI	GCNGC	5 cut(s)	126, 351, 354, 531, 567
HaeIII	GGCC	1 cut(s)	60
HapII	CCGG	1 cut(s)	93
HhaI	GCGC	1 cut(s)	337
Hin1II	CATG	5 cut(s)	32, 269, 434, 502, 648
Hin6I	GCGC	1 cut(s)	335
HinP1I	GCGC	1 cut(s)	335
HindIII	AAGCTT	1 cut(s)	202
HinfI	GANTC	3 cut(s)	41, 77, 613
HpaII	CCGG	1 cut(s)	93
Hpy166II	GTNNAC	1 cut(s)	263
Hpy188I	TCNGA	4 cut(s)	40, 367, 554, 601
Hpy188III	TCNNGA	4 cut(s)	119, 155, 702, 717
Hpy8I	GTNNAC	1 cut(s)	263
HpyAV	CCTTC	2 cut(s)	221, 616
HpyCH4III	ACNGT	3 cut(s)	629, 655, 708
HpyCH4V	TGCA	9 cut(s)	104, 128, 200, 284, 323, 353, 533, 577, 676
HpyF10VI	GCNNNNNNNGC	2 cut(s)	134, 320
Hsp92II	CATG	5 cut(s)	32, 269, 434, 502, 648
HspAI	GCGC	1 cut(s)	335
Kzo9I	GATC	1 cut(s)	160
LmnI	GCTCC	3 cut(s)	25, 439, 595
LpnPI	CCDG	6 cut(s)	106, 135, 168, 255, 662, 707
Lsp1109I	GCAGC	5 cut(s)	112, 337, 365, 517, 553
LweI	GCATC	3 cut(s)	271, 323, 330
MaeI	CTAG	1 cut(s)	702
MaeIII	GTNAC	1 cut(s)	505
MalI	GATC	1 cut(s)	162
MboI	GATC	1 cut(s)	160
MboII	GAAGA	1 cut(s)	170
MfeI	CAATTG	1 cut(s)	318
MflI	RGATCY	1 cut(s)	160
MluCI	AATT	3 cut(s)	177, 318, 544
MmeI	TCCRAC	2 cut(s)	450, 532
MnlI	CCTC	4 cut(s)	95, 115, 384, 631
MseI	TTAA	1 cut(s)	381
MspA1I	CMGCKG	2 cut(s)	356, 530
MspI	CCGG	1 cut(s)	93
MunI	CAATTG	1 cut(s)	318
MwoI	GCNNNNNNNGC	2 cut(s)	134, 320
NdeII	GATC	1 cut(s)	160
NlaIII	CATG	5 cut(s)	32, 269, 434, 502, 648
NlaIV	GGNNCC	2 cut(s)	59, 556
NmuCI	GTSAC	1 cut(s)	505
NspI	RCATGY	2 cut(s)	32, 648
PaeI	GCATGC	2 cut(s)	32, 648
PfeI	GAWTC	3 cut(s)	41, 77, 613
PflMI	CCANNNNNTGG	1 cut(s)	95
PinAI	ACCGGT	1 cut(s)	92
PkrI	GCNGC	5 cut(s)	127, 352, 355, 532, 568
PspN4I	GGNNCC	2 cut(s)	59, 556
PspPI	GGNCC	4 cut(s)	58, 152, 554, 625
PstI	CTGCAG	1 cut(s)	355
PsuI	RGATCY	1 cut(s)	160
PvuII	CAGCTG	2 cut(s)	356, 530
RsaI	GTAC	1 cut(s)	481
RsaNI	GTAC	1 cut(s)	480
SaqAI	TTAA	1 cut(s)	381
SatI	GCNGC	5 cut(s)	126, 351, 354, 531, 567
Sau3AI	GATC	1 cut(s)	160
Sau96I	GGNCC	4 cut(s)	58, 152, 554, 625
ScaI	AGTACT	1 cut(s)	481
SetI	ASST	9 cut(s)	139, 206, 352, 358, 496, 532, 607, 692, 696
SfaNI	GCATC	3 cut(s)	271, 323, 330
SfcI	CTRYAG	1 cut(s)	351
SinI	GGWCC	3 cut(s)	152, 554, 625
SmlI	CTYRAG	1 cut(s)	119
SmoI	CTYRAG	1 cut(s)	119
SphI	GCATGC	2 cut(s)	32, 648
Sse9I	AATT	3 cut(s)	177, 318, 544
SspMI	CTAG	1 cut(s)	702
StyI	CCWWGG	1 cut(s)	559
TaaI	ACNGT	3 cut(s)	629, 655, 708
TasI	AATT	3 cut(s)	177, 318, 544
TatI	WGTACW	1 cut(s)	479
TfiI	GAWTC	3 cut(s)	41, 77, 613
Tru1I	TTAA	1 cut(s)	381
Tru9I	TTAA	1 cut(s)	381
TseFI	GTSAC	1 cut(s)	505
TseI	GCWGC	5 cut(s)	125, 350, 353, 530, 566
Tsp45I	GTSAC	1 cut(s)	505
TspDTI	ATGAA	4 cut(s)	170, 312, 416, 487
Van91I	CCANNNNNTGG	1 cut(s)	95
VpaK11BI	GGWCC	3 cut(s)	152, 554, 625
XapI	RAATTY	1 cut(s)	544
XbaI	TCTAGA	1 cut(s)	701
XceI	RCATGY	2 cut(s)	32, 648
XmiI	GTMKAC	1 cut(s)	262
XspI	CTAG	1 cut(s)	702
ZrmI	AGTACT	1 cut(s)	481

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.