Rmu_sc0013983.1_g000007

Protein CHAPERONE-LIKE PROTEIN OF POR1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013983.1
OG0012266
Physical Location & Seq
Forward (+)
18272 .. 23082
4811 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013983.1_g000007.1.cds

Sequence Viewer

Length: 849 bp
atggctttagcaatttcccatgctcttctctgccccaaattgcagtttccccaaaggaatttccgccctaaagctccagccctgagtttctcacctcccaatttcagagcaattccacagaatagaaggatagtgttggccgctgcatctgcagctggaagttctaattcggacagtggtttgaatccgtatgaggttctcggtgtgaacccgattgaggggtttgacatggtcaaggcagcgtataagaaaaaacacaaggaggctgtaagcaatggtgatgaagaagctgctgctagactggagaaagcatatgacaaacttatgatggcacaactaacaaacaggaagaaaggcttgacatttggttcttttaaggtttcaaaggatataaaatatgccgataagcaaccgattgtaccatgggggcctaggttcaccaaatccagtgtacaagatatgcgtatcaatctggcaatctctgccgtatttgtagcttggcttgttattgtgcaaaacgctgactataaacccctccaatttttatcctttgcattcgtttatcgcatttttgagaagttgaagacctttgaaaaacctgtaactccaacatacacagaagatggtgaggaagtggggaagggactgcagatgggaaaacggctgcttcgtgctcttggactagtctttggctgtattgctgtggcttctctggcatacactggttctctgaatgtgatcgagtatatagctagttacgttcctgctattctttacaataaccaggaattgataatcacctcagtaactgcagtcatgctctacgttatggcatcatattacaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CPP1-like

Protein Analysis

282

Amino Acids

31.3

Weight (kDa)

9.61

Isoelectric Point (pI)

31.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012266)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G08640
fragaria_vesca FvH4_6g01960 FvH4_6g01960
malus_domestica MD09G1286500.v1.1 MD17G1278900.v1.1
prunus_persica Prupe.6G349300_v2.0.a1
pyrus_communis pycom09g19360 pycom17g27650
rosa_chinensis RchiOBHm_Chr3g0449811
rosa_laevigata RLG00000025796 RLG00000025798
rosa_multiflora Rmu_sc0013983.1_g000007
rosa_roxburghii Rroxscaffold_6G00427630
rosa_rugosa Rorug02G0623500
rosa_samantha Rh3AG021700 Rh3BG022400 Rh3CG021000 Rh3DG022100
rosa_wichuraiana Rw3G001780

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 64, 141
AcoI YGGCCR 1 cut(s) 138
AcsI RAATTY 1 cut(s) 58
AfaI GTAC 2 cut(s) 420, 453
AfiI CCNNNNNNNGG 2 cut(s) 217, 218
AgsI TTSAA 4 cut(s) 184, 384, 583, 593
AhlI ACTAGT 1 cut(s) 682
AjnI CCWGG 1 cut(s) 783
AluBI AGCT 5 cut(s) 74, 155, 290, 497, 752
AluI AGCT 5 cut(s) 74, 155, 290, 497, 752
Alw21I GWGCWC 1 cut(s) 676
AlwNI CAGNNNCTG 1 cut(s) 809
AoxI GGCC 2 cut(s) 138, 428
ApeKI GCWGC 6 cut(s) 143, 152, 239, 290, 293, 664
ApoI RAATTY 1 cut(s) 58
AspA2I CCTAGG 1 cut(s) 431
AspS9I GGNCC 1 cut(s) 428
AsuHPI GGTGA 5 cut(s) 84, 290, 430, 638, 790
AvrII CCTAGG 1 cut(s) 431
BbsI GAAGAC 1 cut(s) 590
Bbv12I GWGCWC 1 cut(s) 676
BbvI GCAGC 6 cut(s) 130, 164, 251, 277, 280, 651
BccI CCATC 3 cut(s) 322, 617, 646
BceAI ACGGC 2 cut(s) 470, 677
BciT130I CCWGG 1 cut(s) 785
BcuI ACTAGT 1 cut(s) 682
BfaI CTAG 4 cut(s) 297, 432, 683, 753
BfmI CTRYAG 3 cut(s) 150, 647, 810
BisI GCNGC 7 cut(s) 141, 144, 153, 240, 291, 294, 665
BlnI CCTAGG 1 cut(s) 431
BlsI GCNGC 7 cut(s) 142, 145, 154, 241, 292, 295, 666
Bme1390I CCNGG 1 cut(s) 785
BmgT120I GGNCC 1 cut(s) 428
BmiI GGNNCC 1 cut(s) 429
BmrFI CCNGG 1 cut(s) 785
BmsI GCATC 2 cut(s) 155, 842
BpiI GAAGAC 1 cut(s) 590
BpmI CTGGAG 2 cut(s) 60, 323
BsaJI CCNNGG 2 cut(s) 422, 431
Bsc4I CCNNNNNNNGG 2 cut(s) 217, 218
Bse1I ACTGG 3 cut(s) 306, 447, 727
Bse3DI GCAATG 1 cut(s) 280
BseBI CCWGG 1 cut(s) 785
BseDI CCNNGG 2 cut(s) 422, 431
BseLI CCNNNNNNNGG 2 cut(s) 217, 218
BseMI GCAATG 1 cut(s) 280
BseMII CTCAG 2 cut(s) 74, 816
BseNI ACTGG 3 cut(s) 306, 447, 727
BseXI GCAGC 6 cut(s) 130, 164, 251, 277, 280, 651
BshFI GGCC 2 cut(s) 140, 430
BsiHKAI GWGCWC 1 cut(s) 676
BslFI GGGAC 1 cut(s) 657
BslI CCNNNNNNNGG 2 cut(s) 217, 218
BsmFI GGGAC 1 cut(s) 657
BsmI GAATGC 1 cut(s) 554
BsnI GGCC 2 cut(s) 140, 430
Bsp1286I GDGCHC 1 cut(s) 676
Bsp1407I TGTACA 1 cut(s) 451
Bsp143I GATC 1 cut(s) 738
Bsp19I CCATGG 1 cut(s) 422
BspACI CCGC 2 cut(s) 64, 141
BspANI GGCC 2 cut(s) 140, 430
BspCNI CTCAG 2 cut(s) 75, 815
BspLI GGNNCC 1 cut(s) 429
BspMAI CTGCAG 3 cut(s) 154, 651, 814
BspQI GCTCTTC 1 cut(s) 30
BsrDI GCAATG 1 cut(s) 280
BsrGI TGTACA 1 cut(s) 451
BsrI ACTGG 3 cut(s) 306, 447, 727
BssECI CCNNGG 2 cut(s) 422, 431
BssMI GATC 1 cut(s) 738
BssT1I CCWWGG 2 cut(s) 422, 431
Bst2UI CCWGG 1 cut(s) 785
Bst4CI ACNGT 1 cut(s) 176
Bst6I CTCTTC 1 cut(s) 30
BstAPI GCANNNNNTGC 1 cut(s) 482
BstAUI TGTACA 1 cut(s) 451
BstDEI CTNAG 2 cut(s) 83, 802
BstDSI CCRYGG 1 cut(s) 422
BstKTI GATC 1 cut(s) 741
BstMBI GATC 1 cut(s) 738
BstMWI GCNNNNNNNGC 4 cut(s) 149, 152, 482, 713
BstNI CCWGG 1 cut(s) 785
BstSCI CCNGG 1 cut(s) 783
BstSFI CTRYAG 3 cut(s) 150, 647, 810
BstV1I GCAGC 6 cut(s) 130, 164, 251, 277, 280, 651
BstV2I GAAGAC 1 cut(s) 590
BsuRI GGCC 2 cut(s) 140, 430
BtgI CCRYGG 1 cut(s) 422
BtsIMutI CAGTG 3 cut(s) 181, 454, 720
CaiI CAGNNNCTG 1 cut(s) 809
Cfr13I GGNCC 1 cut(s) 428
Csp6I GTAC 2 cut(s) 419, 452
CviAII CATG 4 cut(s) 20, 229, 423, 817
CviQI GTAC 2 cut(s) 419, 452
DdeI CTNAG 2 cut(s) 83, 802
DpnI GATC 1 cut(s) 740
DpnII GATC 1 cut(s) 738
EaeI YGGCCR 1 cut(s) 138
Eam1104I CTCTTC 1 cut(s) 30
EarI CTCTTC 1 cut(s) 30
EciI GGCGGA 1 cut(s) 53
Eco130I CCWWGG 2 cut(s) 422, 431
EcoO109I RGGNCCY 1 cut(s) 428
EcoRII CCWGG 1 cut(s) 783
EcoT14I CCWWGG 2 cut(s) 422, 431
ErhI CCWWGG 2 cut(s) 422, 431
FaeI CATG 4 cut(s) 23, 232, 426, 820
FalI AAGNNNNNCTT 2 cut(s) 341, 373
FaqI GGGAC 1 cut(s) 657
FatI CATG 4 cut(s) 19, 228, 422, 816
FauNDI CATATG 1 cut(s) 313
Fnu4HI GCNGC 7 cut(s) 141, 144, 153, 240, 291, 294, 665
Fsp4HI GCNGC 7 cut(s) 141, 144, 153, 240, 291, 294, 665
FspBI CTAG 4 cut(s) 297, 432, 683, 753
GluI GCNGC 7 cut(s) 141, 144, 153, 240, 291, 294, 665
GsuI CTGGAG 2 cut(s) 60, 323
HaeIII GGCC 2 cut(s) 140, 430
Hin1II CATG 4 cut(s) 23, 232, 426, 820
HinfI GANTC 1 cut(s) 184
HphI GGTGA 5 cut(s) 84, 290, 430, 638, 790
Hpy166II GTNNAC 3 cut(s) 208, 438, 452
Hpy188I TCNGA 3 cut(s) 107, 172, 732
Hpy8I GTNNAC 3 cut(s) 208, 438, 452
HpyAV CCTTC 2 cut(s) 120, 634
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4IV ACGT 2 cut(s) 759, 825
HpyCH4V TGCA 7 cut(s) 43, 146, 152, 514, 554, 649, 812
HpyF10VI GCNNNNNNNGC 4 cut(s) 149, 152, 482, 713
HpyF3I CTNAG 2 cut(s) 83, 802
HpySE526I ACGT 2 cut(s) 759, 825
Hsp92II CATG 4 cut(s) 23, 232, 426, 820
Kzo9I GATC 1 cut(s) 738
LguI GCTCTTC 1 cut(s) 30
LmnI GCTCC 1 cut(s) 79
Lsp1109I GCAGC 6 cut(s) 130, 164, 251, 277, 280, 651
LweI GCATC 2 cut(s) 155, 842
MaeI CTAG 4 cut(s) 297, 432, 683, 753
MaeII ACGT 2 cut(s) 759, 825
MaeIII GTNAC 3 cut(s) 601, 755, 805
MalI GATC 1 cut(s) 740
MboI GATC 1 cut(s) 738
MboII GAAGA 5 cut(s) 17, 296, 361, 595, 632
MhlI GDGCHC 1 cut(s) 676
MluCI AATT 8 cut(s) 12, 38, 58, 100, 111, 166, 539, 788
MmeI TCCRAC 1 cut(s) 632
MnlI CCTC 7 cut(s) 105, 187, 211, 256, 545, 622, 811
MseI TTAA 1 cut(s) 375
MspA1I CMGCKG 2 cut(s) 143, 155
MspR9I CCNGG 1 cut(s) 785
Mva1269I GAATGC 1 cut(s) 554
MvaI CCWGG 1 cut(s) 785
MwoI GCNNNNNNNGC 4 cut(s) 149, 152, 482, 713
NcoI CCATGG 1 cut(s) 422
NdeI CATATG 1 cut(s) 313
NdeII GATC 1 cut(s) 738
NlaIII CATG 4 cut(s) 23, 232, 426, 820
NlaIV GGNNCC 1 cut(s) 429
PciSI GCTCTTC 1 cut(s) 30
PcsI WCGNNNNNNNCGW 1 cut(s) 667
PctI GAATGC 1 cut(s) 554
PfeI GAWTC 1 cut(s) 184
PflFI GACNNNGTC 1 cut(s) 230
PkrI GCNGC 7 cut(s) 142, 145, 154, 241, 292, 295, 666
Psp6I CCWGG 1 cut(s) 783
PspGI CCWGG 1 cut(s) 783
PspN4I GGNNCC 1 cut(s) 429
PspPI GGNCC 1 cut(s) 428
PstI CTGCAG 3 cut(s) 154, 651, 814
PstNI CAGNNNCTG 1 cut(s) 809
PsyI GACNNNGTC 1 cut(s) 230
PvuII CAGCTG 1 cut(s) 155
RsaI GTAC 2 cut(s) 420, 453
RsaNI GTAC 2 cut(s) 419, 452
SapI GCTCTTC 1 cut(s) 30
SaqAI TTAA 1 cut(s) 375
SatI GCNGC 7 cut(s) 141, 144, 153, 240, 291, 294, 665
Sau3AI GATC 1 cut(s) 738
Sau96I GGNCC 1 cut(s) 428
ScrFI CCNGG 1 cut(s) 785
SduI GDGCHC 1 cut(s) 676
SfaNI GCATC 2 cut(s) 155, 842
SfcI CTRYAG 3 cut(s) 150, 647, 810
SpeI ACTAGT 1 cut(s) 682
Sse9I AATT 8 cut(s) 12, 38, 58, 100, 111, 166, 539, 788
SsiI CCGC 2 cut(s) 64, 141
SspMI CTAG 4 cut(s) 297, 432, 683, 753
StyD4I CCNGG 1 cut(s) 783
StyI CCWWGG 2 cut(s) 422, 431
TaaI ACNGT 1 cut(s) 176
TaiI ACGT 2 cut(s) 762, 828
TaqI TCGA 1 cut(s) 741
TasI AATT 8 cut(s) 12, 38, 58, 100, 111, 166, 539, 788
TatI WGTACW 1 cut(s) 451
TauI GCSGC 1 cut(s) 143
TfiI GAWTC 1 cut(s) 184
Tru1I TTAA 1 cut(s) 375
Tru9I TTAA 1 cut(s) 375
TscAI CASTG 3 cut(s) 181, 454, 727
TseI GCWGC 6 cut(s) 143, 152, 239, 290, 293, 664
TspDTI ATGAA 1 cut(s) 297
TspGWI ACGGA 1 cut(s) 177
TspRI CASTG 3 cut(s) 181, 454, 727
Tth111I GACNNNGTC 1 cut(s) 230
XapI RAATTY 1 cut(s) 58
XmaJI CCTAGG 1 cut(s) 431
XspI CTAG 4 cut(s) 297, 432, 683, 753
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.