Rmu_sc0015149.1_g000003
BZIP Family

G-box-binding factor 1-like isoform X1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015149.1
Physical Location & Seq
Reverse (-)
9517 .. 12692
3176 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015149.1_g000003.1.cds

Sequence Viewer

Length: 900 bp
atggagaacaaggaaaccagtgctgcttcaactcagggtgtggcattagaaattcaagataaagaagaaagggttctcaatgagaaggacatggaatcaatgacgccaatgacaacaactaaggaaggctcagtagacattgaggtggtaggcaatagagttgcagatagcgaaaaggaaacttctttttctggaaatagtggtgacggtgtttcacagggtgctgcaggcagaggcgaggattcatcagatgagaatgctgacactaaccgagatttttctgcaattcaaaagcaaatttttaaccagatgggggcagttcagaataattctagagtcctttatagtggcatggatacaaatttgaaattgttgaatattgggataaacatgcctgaaacccatccgaattcgggactggacctgaatgtatccagtgctcatgccatactcacagaggaagatcacgactggagaagaagagaaaagagaaagcagtctaatagggagtcagctaagaggtcaagattccgtaggcagcaagaatgtgagaaactacgagaaactgcagcgatgctgaatagtgaaatctcagagctcccaaatgagttaagaaggctttctgaggagtgtgggaaacttgatgaagaaaacagttccctaattgatgagatggagaagatgtatggtccagatgcagttgctgatctcagagctgtgaaagtcaactcttccgatgatggaagcaacagcatcgaatcaaaaactccaagcagagacaactcaacttctcctactcctcatcaaaaagagacttctcctactcctgagcctcgattatttggtgtcagcctacgaccaaacttggctgattgtttacatagttcaaaggtccagtaa

Protein Analysis

299

Amino Acids

33.11

Weight (kDa)

4.89

Isoelectric Point (pI)

57.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 135
AcsI RAATTY 4 cut(s) 51, 297, 361, 409
AcyI GRCGYC 1 cut(s) 104
AdeI CACNNNGTG 1 cut(s) 221
AfiI CCNNNNNNNGG 2 cut(s) 313, 413
AgsI TTSAA 6 cut(s) 30, 56, 290, 367, 376, 888
AluBI AGCT 3 cut(s) 515, 598, 716
AluI AGCT 3 cut(s) 515, 598, 716
Alw21I GWGCWC 2 cut(s) 442, 600
Alw26I GTCTC 2 cut(s) 771, 806
AlwNI CAGNNNCTG 1 cut(s) 704
ApeKI GCWGC 4 cut(s) 23, 224, 538, 569
ApoI RAATTY 4 cut(s) 51, 297, 361, 409
Asp700I GAANNNNTTC 2 cut(s) 72, 619
AspS9I GGNCC 3 cut(s) 421, 689, 892
AsuHPI GGTGA 1 cut(s) 215
AvaII GGWCC 3 cut(s) 421, 689, 892
BanII GRGCYC 1 cut(s) 600
Bbv12I GWGCWC 2 cut(s) 442, 600
BbvI GCAGC 4 cut(s) 10, 211, 550, 581
BccI CCATC 4 cut(s) 304, 411, 667, 734
BcgI CGANNNNNNTGC 2 cut(s) 736, 770
BciVI GTATCC 2 cut(s) 349, 442
BcoDI GTCTC 2 cut(s) 771, 806
BfaI CTAG 1 cut(s) 333
BfmI CTRYAG 2 cut(s) 225, 567
BfuI GTATCC 2 cut(s) 349, 442
BisI GCNGC 4 cut(s) 24, 225, 539, 570
BlsI GCNGC 4 cut(s) 25, 226, 540, 571
Bme18I GGWCC 3 cut(s) 421, 689, 892
BmgT120I GGNCC 3 cut(s) 421, 689, 892
BmsI GCATC 3 cut(s) 564, 685, 762
BpmI CTGGAG 1 cut(s) 493
Bpu10I CCTNAGC 1 cut(s) 828
BsaHI GRCGYC 1 cut(s) 104
BsaXI ACNNNNNCTCC 2 cut(s) 668, 698
Bsc4I CCNNNNNNNGG 2 cut(s) 313, 413
Bse1I ACTGG 5 cut(s) 18, 423, 435, 476, 895
BseGI GGATG 1 cut(s) 403
BseLI CCNNNNNNNGG 2 cut(s) 313, 413
BseMII CTCAG 6 cut(s) 47, 144, 606, 615, 724, 819
BseNI ACTGG 5 cut(s) 18, 423, 435, 476, 895
BseRI GAGGAG 2 cut(s) 641, 789
BseXI GCAGC 4 cut(s) 10, 211, 550, 581
BsiHKAI GWGCWC 2 cut(s) 442, 600
BslFI GGGAC 1 cut(s) 429
BslI CCNNNNNNNGG 2 cut(s) 313, 413
BsmAI GTCTC 2 cut(s) 771, 806
BsmFI GGGAC 1 cut(s) 429
BsmI GAATGC 1 cut(s) 262
Bsp1286I GDGCHC 2 cut(s) 442, 600
Bsp143I GATC 2 cut(s) 463, 706
BspCNI CTCAG 6 cut(s) 46, 143, 605, 616, 723, 820
BspMAI CTGCAG 2 cut(s) 229, 571
BsrI ACTGG 5 cut(s) 18, 423, 435, 476, 895
BssMI GATC 2 cut(s) 463, 706
BssNI GRCGYC 1 cut(s) 104
Bst4CI ACNGT 2 cut(s) 209, 656
Bst6I CTCTTC 2 cut(s) 475, 736
BstACI GRCGYC 1 cut(s) 104
BstC8I GCNNGC 1 cut(s) 229
BstDEI CTNAG 8 cut(s) 33, 120, 130, 516, 592, 624, 710, 828
BstF5I GGATG 1 cut(s) 403
BstKTI GATC 2 cut(s) 466, 709
BstMAI GTCTC 2 cut(s) 771, 806
BstMBI GATC 2 cut(s) 463, 706
BstNSI RCATGY 1 cut(s) 394
BstSFI CTRYAG 2 cut(s) 225, 567
BstV1I GCAGC 4 cut(s) 10, 211, 550, 581
BsuI GTATCC 2 cut(s) 349, 442
BtgZI GCGATG 1 cut(s) 587
BtsCI GGATG 1 cut(s) 403
BtsIMutI CAGTG 2 cut(s) 25, 442
Cac8I GCNNGC 1 cut(s) 229
CaiI CAGNNNCTG 1 cut(s) 704
Cfr13I GGNCC 3 cut(s) 421, 689, 892
CseI GACGC 1 cut(s) 112
CviAII CATG 4 cut(s) 91, 352, 391, 443
CviJI RGCY 8 cut(s) 129, 515, 598, 619, 716, 832, 852, 869
CviKI_1 RGCY 8 cut(s) 129, 515, 598, 619, 716, 832, 852, 869
DdeI CTNAG 8 cut(s) 33, 120, 130, 516, 592, 624, 710, 828
DpnI GATC 2 cut(s) 465, 708
DpnII GATC 2 cut(s) 463, 706
DraIII CACNNNGTG 1 cut(s) 221
Eam1104I CTCTTC 2 cut(s) 475, 736
EarI CTCTTC 2 cut(s) 475, 736
Ecl136II GAGCTC 1 cut(s) 598
Eco24I GRGCYC 1 cut(s) 600
Eco47I GGWCC 3 cut(s) 421, 689, 892
Eco53kI GAGCTC 1 cut(s) 598
EcoICRI GAGCTC 1 cut(s) 598
EcoRI GAATTC 1 cut(s) 409
EcoT38I GRGCYC 1 cut(s) 600
FaeI CATG 4 cut(s) 94, 355, 394, 446
FaiI YATR 8 cut(s) 92, 345, 353, 392, 444, 449, 687, 882
FaqI GGGAC 1 cut(s) 429
FatI CATG 4 cut(s) 90, 351, 390, 442
FblI GTMKAC 1 cut(s) 135
Fnu4HI GCNGC 4 cut(s) 24, 225, 539, 570
FokI GGATG 1 cut(s) 390
FriOI GRGCYC 1 cut(s) 600
Fsp4HI GCNGC 4 cut(s) 24, 225, 539, 570
FspBI CTAG 1 cut(s) 333
GluI GCNGC 4 cut(s) 24, 225, 539, 570
GsuI CTGGAG 1 cut(s) 493
HgaI GACGC 1 cut(s) 112
Hin1I GRCGYC 1 cut(s) 104
Hin1II CATG 4 cut(s) 94, 355, 394, 446
HincII GTYRAC 1 cut(s) 727
HindII GTYRAC 1 cut(s) 727
HinfI GANTC 6 cut(s) 95, 242, 336, 509, 528, 758
HphI GGTGA 1 cut(s) 215
Hpy166II GTNNAC 3 cut(s) 136, 727, 878
Hpy188I TCNGA 7 cut(s) 250, 324, 408, 595, 625, 713, 736
Hpy188III TCNNGA 8 cut(s) 56, 192, 333, 414, 467, 525, 692, 827
Hpy8I GTNNAC 3 cut(s) 136, 727, 878
HpyAV CCTTC 3 cut(s) 79, 119, 609
HpyCH4III ACNGT 2 cut(s) 209, 656
HpyCH4V TGCA 5 cut(s) 164, 227, 284, 569, 698
HpyF3I CTNAG 8 cut(s) 33, 120, 130, 516, 592, 624, 710, 828
Hsp92I GRCGYC 1 cut(s) 104
Hsp92II CATG 4 cut(s) 94, 355, 394, 446
Kzo9I GATC 2 cut(s) 463, 706
LmnI GCTCC 1 cut(s) 603
Lsp1109I GCAGC 4 cut(s) 10, 211, 550, 581
LweI GCATC 3 cut(s) 564, 685, 762
MaeI CTAG 1 cut(s) 333
MaeIII GTNAC 1 cut(s) 203
MalI GATC 2 cut(s) 465, 708
MboI GATC 2 cut(s) 463, 706
MboII GAAGA 7 cut(s) 77, 473, 489, 492, 659, 691, 723
MhlI GDGCHC 2 cut(s) 442, 600
MluCI AATT 8 cut(s) 51, 285, 297, 328, 361, 368, 409, 663
MlyI GAGTC 2 cut(s) 345, 518
MnlI CCTC 8 cut(s) 136, 227, 232, 451, 513, 619, 810, 843
MroXI GAANNNNTTC 2 cut(s) 72, 619
MseI TTAA 2 cut(s) 303, 611
MslI CAYNNNNRTG 1 cut(s) 143
Mva1269I GAATGC 1 cut(s) 262
NdeII GATC 2 cut(s) 463, 706
NlaIII CATG 4 cut(s) 94, 355, 394, 446
NmuCI GTSAC 1 cut(s) 203
NspI RCATGY 1 cut(s) 394
PctI GAATGC 1 cut(s) 262
PdmI GAANNNNTTC 2 cut(s) 72, 619
PfeI GAWTC 4 cut(s) 95, 242, 528, 758
PkrI GCNGC 4 cut(s) 25, 226, 540, 571
PleI GAGTC 2 cut(s) 344, 517
PpsI GAGTC 2 cut(s) 344, 517
Psp124BI GAGCTC 1 cut(s) 600
PspPI GGNCC 3 cut(s) 421, 689, 892
PstI CTGCAG 2 cut(s) 229, 571
PstNI CAGNNNCTG 1 cut(s) 704
RseI CAYNNNNRTG 1 cut(s) 143
SacI GAGCTC 1 cut(s) 600
SaqAI TTAA 2 cut(s) 303, 611
SatI GCNGC 4 cut(s) 24, 225, 539, 570
Sau3AI GATC 2 cut(s) 463, 706
Sau96I GGNCC 3 cut(s) 421, 689, 892
SchI GAGTC 2 cut(s) 345, 518
SduI GDGCHC 2 cut(s) 442, 600
SetI ASST 7 cut(s) 147, 426, 517, 524, 600, 718, 894
SfaNI GCATC 3 cut(s) 564, 685, 762
SfcI CTRYAG 2 cut(s) 225, 567
SinI GGWCC 3 cut(s) 421, 689, 892
SmiMI CAYNNNNRTG 1 cut(s) 143
Sse9I AATT 8 cut(s) 51, 285, 297, 328, 361, 368, 409, 663
SspI AATATT 1 cut(s) 379
SspMI CTAG 1 cut(s) 333
SstI GAGCTC 1 cut(s) 600
TaaI ACNGT 2 cut(s) 209, 656
TaqI TCGA 2 cut(s) 756, 835
TasI AATT 8 cut(s) 51, 285, 297, 328, 361, 368, 409, 663
TfiI GAWTC 4 cut(s) 95, 242, 528, 758
Tru1I TTAA 2 cut(s) 303, 611
Tru9I TTAA 2 cut(s) 303, 611
TscAI CASTG 2 cut(s) 25, 442
TseFI GTSAC 1 cut(s) 203
TseI GCWGC 4 cut(s) 23, 224, 538, 569
Tsp45I GTSAC 1 cut(s) 203
TspDTI ATGAA 2 cut(s) 234, 660
TspGWI ACGGA 1 cut(s) 521
TspRI CASTG 2 cut(s) 25, 442
VpaK11BI GGWCC 3 cut(s) 421, 689, 892
XapI RAATTY 4 cut(s) 51, 297, 361, 409
XbaI TCTAGA 1 cut(s) 332
XceI RCATGY 1 cut(s) 394
XmiI GTMKAC 1 cut(s) 135
XmnI GAANNNNTTC 2 cut(s) 72, 619
XspI CTAG 1 cut(s) 333
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.