Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017689.1

Orthogroup ID

OG0002898

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 2169

Gene Structure 2169 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017689.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 906 bp

gtgttaaatatgctctgttgttgggcggaggatccaaactcagaggcattcaagttgcatcttccaagactatatgattatttgtggatcgctgaagatggcatgaaaatgcagggctacaatgggagccaggcatgggatacttcttttgctgtgcaagcaataatatctactaaccttgctaaagaatatggacctactttaagaaaagcacatgaatacataaaagattctcaggtcttagaagattgtcctggtgatctaaacttttggtatcgacacatttcaaaaggtgcttggccattctcaactgcagatcatggatggcctatctctgactgcacggcggaaggactgaagttaacttggtcactcaaaatttcacatacagaaacactcgatacaccacagaataatgatggtggatttgcaacttatgaattgactagatcatataagtggttggagctaatcaaccctgcagaaacttttggtgacattgtaatagattatccatatgttgagtgtacatcagcagcaattcaagcactcacactatttaagaaattatatcctggacataggagggaagaaatagaaaactgtattgctaatgctgcaaagttcattgaaaagatacaagcaacagatggctcttggtatggttcttggggagtctgcttcacctatgctggctggtttggcataaagggtttggttgctgctggaaggacttatgaagactgctctcgcatccgtaaagcatgtgattttttgttatccaaagagcttgcttctggtggatggggagaaagttatctatcatgtcagaacaaggtaaatggtgtaccaaatttgatatatcctttccttgtcttttctaggcttgaaacttattatatttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00100 ko01100 ko01110 map00100 map01100 map01110

Pfam Domains

Protein Families

SQHop_cyclase_C SQHop_cyclase_N

Protein Analysis

301

Amino Acids

34.15

Weight (kDa)

5.22

Isoelectric Point (pI)

34.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002898)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G07050 AT2G07050
fragaria_vesca	FvH4_4g05990 FvH4_4g05990 FvH4_4g05990 FvH4_4g05990 FvH4_6g36510 FvH4_6g36510
malus_domestica	MD00G1130000.v1.1 MD00G1220900.v1.1 MD13G1232100.v1.1 MD16G1237000.v1.1 MD17G1159900.v1.1 MD17G1245900.v1.1 MD17G1246400.v1.1
prunus_persica	Prupe.1G063400_v2.0.a1 Prupe.3G026100_v2.0.a1 Prupe.3G026100_v2.0.a1
pyrus_communis	pycom09g08550
rosa_chinensis	RchiOBHm_Chr2g0148711 RchiOBHm_Chr2g0148821 RchiOBHm_Chr2g0148951 RchiOBHm_Chr4g0397221
rosa_laevigata	RLG00000009438 RLG00000020359
rosa_multiflora	Rmu_sc0001796.1_g000004 Rmu_sc0002312.1_g000065 Rmu_sc0008532.1_g000008 Rmu_sc0017689.1_g000001
rosa_roxburghii	Rroxscaffold_2G00098550 Rroxscaffold_5G00342160
rosa_rugosa	Rorug03G0225900 Rorug03G0343900 Rorug03G0343900
rosa_samantha	Rh2AG467200 Rh2DG488900
rosa_wichuraiana	Rw2G038090 Rw4G006310

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	26, 347
AclWI	GGATC	3 cut(s)	26, 39, 95
AcoI	YGGCCR	1 cut(s)	299
AcsI	RAATTY	2 cut(s)	378, 853
AcuI	CTGAAG	2 cut(s)	114, 377
AfaI	GTAC	2 cut(s)	529, 849
AfiI	CCNNNNNNNGG	1 cut(s)	136
AgsI	TTSAA	5 cut(s)	52, 288, 545, 632, 890
AjnI	CCWGG	3 cut(s)	129, 253, 574
AluBI	AGCT	2 cut(s)	469, 790
AluI	AGCT	2 cut(s)	469, 790
AlwI	GGATC	3 cut(s)	26, 39, 95
AoxI	GGCC	2 cut(s)	299, 326
ApeKI	GCWGC	3 cut(s)	536, 617, 722
ApoI	RAATTY	2 cut(s)	378, 853
AspS9I	GGNCC	1 cut(s)	194
AsuHPI	GGTGA	3 cut(s)	269, 506, 676
AvaII	GGWCC	1 cut(s)	194
BalI	TGGCCA	1 cut(s)	301
BamHI	GGATCC	1 cut(s)	31
BbsI	GAAGAC	1 cut(s)	747
BbvI	GCAGC	3 cut(s)	548, 604, 709
BccI	CCATC	5 cut(s)	92, 318, 413, 644, 798
BceAI	ACGGC	1 cut(s)	360
BciT130I	CCWGG	3 cut(s)	131, 255, 576
BciVI	GTATCC	1 cut(s)	133
BfaI	CTAG	2 cut(s)	447, 882
BfmI	CTRYAG	2 cut(s)	312, 480
BfuI	GTATCC	1 cut(s)	133
BisI	GCNGC	3 cut(s)	537, 618, 723
BlsI	GCNGC	3 cut(s)	538, 619, 724
Bme1390I	CCNGG	3 cut(s)	131, 255, 576
Bme18I	GGWCC	1 cut(s)	194
BmgT120I	GGNCC	1 cut(s)	194
BmiI	GGNNCC	2 cut(s)	33, 128
BmrFI	CCNGG	3 cut(s)	131, 255, 576
BmsI	GCATC	2 cut(s)	67, 762
BpiI	GAAGAC	1 cut(s)	747
Bsc4I	CCNNNNNNNGG	1 cut(s)	136
BseBI	CCWGG	3 cut(s)	131, 255, 576
BseGI	GGATG	3 cut(s)	329, 753, 809
BseLI	CCNNNNNNNGG	1 cut(s)	136
BseMII	CTCAG	2 cut(s)	54, 248
BseXI	GCAGC	3 cut(s)	548, 604, 709
BsgI	GTGCAG	1 cut(s)	325
BshFI	GGCC	2 cut(s)	301, 328
BslI	CCNNNNNNNGG	1 cut(s)	136
BsmI	GAATGC	1 cut(s)	47
BsnI	GGCC	2 cut(s)	301, 328
Bsp1407I	TGTACA	1 cut(s)	527
Bsp143I	GATC	5 cut(s)	31, 87, 259, 316, 449
BspACI	CCGC	2 cut(s)	26, 347
BspANI	GGCC	2 cut(s)	301, 328
BspCNI	CTCAG	2 cut(s)	53, 247
BspLI	GGNNCC	2 cut(s)	33, 128
BspMAI	CTGCAG	2 cut(s)	316, 484
BspPI	GGATC	3 cut(s)	26, 39, 95
BsrGI	TGTACA	1 cut(s)	527
BssMI	GATC	5 cut(s)	31, 87, 259, 316, 449
Bst2UI	CCWGG	3 cut(s)	131, 255, 576
Bst4CI	ACNGT	1 cut(s)	605
BstAUI	TGTACA	1 cut(s)	527
BstC8I	GCNNGC	3 cut(s)	159, 694, 792
BstDEI	CTNAG	3 cut(s)	40, 234, 241
BstF5I	GGATG	3 cut(s)	329, 753, 809
BstKTI	GATC	5 cut(s)	34, 90, 262, 319, 452
BstMBI	GATC	5 cut(s)	31, 87, 259, 316, 449
BstMWI	GCNNNNNNNGC	4 cut(s)	158, 545, 617, 702
BstNI	CCWGG	3 cut(s)	131, 255, 576
BstNSI	RCATGY	1 cut(s)	768
BstSCI	CCNGG	3 cut(s)	129, 253, 574
BstSFI	CTRYAG	2 cut(s)	312, 480
BstV1I	GCAGC	3 cut(s)	548, 604, 709
BstV2I	GAAGAC	1 cut(s)	747
BstX2I	RGATCY	1 cut(s)	31
BstYI	RGATCY	1 cut(s)	31
BsuI	GTATCC	1 cut(s)	133
BsuRI	GGCC	2 cut(s)	301, 328
BtsCI	GGATG	3 cut(s)	329, 753, 809
Cac8I	GCNNGC	3 cut(s)	159, 694, 792
Cfr13I	GGNCC	1 cut(s)	194
Csp6I	GTAC	2 cut(s)	528, 848
CviAII	CATG	6 cut(s)	103, 135, 215, 320, 765, 825
CviJI	RGCY	9 cut(s)	117, 129, 301, 328, 469, 654, 696, 790, 886
CviKI_1	RGCY	9 cut(s)	117, 129, 301, 328, 469, 654, 696, 790, 886
CviQI	GTAC	2 cut(s)	528, 848
DdeI	CTNAG	3 cut(s)	40, 234, 241
DpnI	GATC	5 cut(s)	33, 89, 261, 318, 451
DpnII	GATC	5 cut(s)	31, 87, 259, 316, 449
EaeI	YGGCCR	1 cut(s)	299
EciI	GGCGGA	2 cut(s)	41, 362
Eco47I	GGWCC	1 cut(s)	194
Eco57I	CTGAAG	2 cut(s)	114, 377
EcoRII	CCWGG	3 cut(s)	129, 253, 574
FaeI	CATG	6 cut(s)	106, 138, 218, 323, 768, 828
FatI	CATG	6 cut(s)	102, 134, 214, 319, 764, 824
FauNDI	CATATG	1 cut(s)	517
Fnu4HI	GCNGC	3 cut(s)	537, 618, 723
FokI	GGATG	3 cut(s)	336, 740, 816
Fsp4HI	GCNGC	3 cut(s)	537, 618, 723
FspBI	CTAG	2 cut(s)	447, 882
GluI	GCNGC	3 cut(s)	537, 618, 723
HaeIII	GGCC	2 cut(s)	301, 328
Hin1II	CATG	6 cut(s)	106, 138, 218, 323, 768, 828
HincII	GTYRAC	1 cut(s)	363
HindII	GTYRAC	1 cut(s)	363
HinfI	GANTC	2 cut(s)	230, 675
HpaI	GTTAAC	1 cut(s)	363
HphI	GGTGA	3 cut(s)	269, 506, 676
Hpy166II	GTNNAC	3 cut(s)	363, 528, 848
Hpy188I	TCNGA	3 cut(s)	43, 337, 831
Hpy8I	GTNNAC	3 cut(s)	363, 528, 848
HpyAV	CCTTC	2 cut(s)	344, 723
HpyCH4III	ACNGT	1 cut(s)	605
HpyCH4V	TGCA	8 cut(s)	58, 112, 157, 314, 342, 431, 482, 620
HpyF10VI	GCNNNNNNNGC	4 cut(s)	158, 545, 617, 702
HpyF3I	CTNAG	3 cut(s)	40, 234, 241
Hsp92II	CATG	6 cut(s)	106, 138, 218, 323, 768, 828
KspAI	GTTAAC	1 cut(s)	363
Kzo9I	GATC	5 cut(s)	31, 87, 259, 316, 449
LmnI	GCTCC	2 cut(s)	126, 466
Lsp1109I	GCAGC	3 cut(s)	548, 604, 709
LweI	GCATC	2 cut(s)	67, 762
MaeI	CTAG	2 cut(s)	447, 882
MaeIII	GTNAC	2 cut(s)	369, 494
MalI	GATC	5 cut(s)	33, 89, 261, 318, 451
MboI	GATC	5 cut(s)	31, 87, 259, 316, 449
MboII	GAAGA	5 cut(s)	53, 107, 257, 602, 752
MflI	RGATCY	1 cut(s)	31
MlsI	TGGCCA	1 cut(s)	301
MluCI	AATT	5 cut(s)	378, 440, 540, 566, 853
MluNI	TGGCCA	1 cut(s)	301
MlyI	GAGTC	1 cut(s)	684
MmeI	TCCRAC	1 cut(s)	444
MnlI	CCTC	3 cut(s)	22, 37, 579
Mox20I	TGGCCA	1 cut(s)	301
MscI	TGGCCA	1 cut(s)	301
MseI	TTAA	5 cut(s)	5, 203, 362, 561, 904
MslI	CAYNNNNRTG	2 cut(s)	107, 457
Msp20I	TGGCCA	1 cut(s)	301
MspR9I	CCNGG	3 cut(s)	131, 255, 576
Mva1269I	GAATGC	1 cut(s)	47
MvaI	CCWGG	3 cut(s)	131, 255, 576
MwoI	GCNNNNNNNGC	4 cut(s)	158, 545, 617, 702
NdeI	CATATG	1 cut(s)	517
NdeII	GATC	5 cut(s)	31, 87, 259, 316, 449
NlaIII	CATG	6 cut(s)	106, 138, 218, 323, 768, 828
NlaIV	GGNNCC	2 cut(s)	33, 128
NmuCI	GTSAC	2 cut(s)	369, 494
NspI	RCATGY	1 cut(s)	768
PctI	GAATGC	1 cut(s)	47
PfeI	GAWTC	1 cut(s)	230
PfoI	TCCNGGA	1 cut(s)	574
PkrI	GCNGC	3 cut(s)	538, 619, 724
PleI	GAGTC	1 cut(s)	683
PpsI	GAGTC	1 cut(s)	683
Psp6I	CCWGG	3 cut(s)	129, 253, 574
PspGI	CCWGG	3 cut(s)	129, 253, 574
PspN4I	GGNNCC	2 cut(s)	33, 128
PspPI	GGNCC	1 cut(s)	194
PstI	CTGCAG	2 cut(s)	316, 484
PsuI	RGATCY	1 cut(s)	31
RsaI	GTAC	2 cut(s)	529, 849
RsaNI	GTAC	2 cut(s)	528, 848
RseI	CAYNNNNRTG	2 cut(s)	107, 457
SaqAI	TTAA	5 cut(s)	5, 203, 362, 561, 904
SatI	GCNGC	3 cut(s)	537, 618, 723
Sau3AI	GATC	5 cut(s)	31, 87, 259, 316, 449
Sau96I	GGNCC	1 cut(s)	194
SchI	GAGTC	1 cut(s)	684
ScrFI	CCNGG	3 cut(s)	131, 255, 576
SetI	ASST	8 cut(s)	180, 199, 240, 295, 471, 689, 792, 840
SfaNI	GCATC	2 cut(s)	67, 762
SfcI	CTRYAG	2 cut(s)	312, 480
SinI	GGWCC	1 cut(s)	194
SmiMI	CAYNNNNRTG	2 cut(s)	107, 457
Sse9I	AATT	5 cut(s)	378, 440, 540, 566, 853
SsiI	CCGC	2 cut(s)	26, 347
SspMI	CTAG	2 cut(s)	447, 882
StyD4I	CCNGG	3 cut(s)	129, 253, 574
TaaI	ACNGT	1 cut(s)	605
TaqI	TCGA	2 cut(s)	277, 399
TasI	AATT	5 cut(s)	378, 440, 540, 566, 853
TatI	WGTACW	1 cut(s)	527
TfiI	GAWTC	1 cut(s)	230
Tru1I	TTAA	5 cut(s)	5, 203, 362, 561, 904
Tru9I	TTAA	5 cut(s)	5, 203, 362, 561, 904
TseFI	GTSAC	2 cut(s)	369, 494
TseI	GCWGC	3 cut(s)	536, 617, 722
Tsp45I	GTSAC	2 cut(s)	369, 494
TspDTI	ATGAA	5 cut(s)	119, 231, 453, 616, 753
TspGWI	ACGGA	1 cut(s)	746
VpaK11BI	GGWCC	1 cut(s)	194
XapI	RAATTY	2 cut(s)	378, 853
XceI	RCATGY	1 cut(s)	768
XspI	CTAG	2 cut(s)	447, 882

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.