Rmu_sc0018683.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018683.1
OG0007116
Physical Location & Seq
Reverse (-)
12000 .. 12398
399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018683.1_g000003.1.cds

Sequence Viewer

Length: 399 bp
atgacacaatgttctagcattccaagatatcgacctccagtcagaagcacagaaggggaaaatgcagatgttagcgaggaaatgagacgcaatttactttctagaaagagcctaagcgaccttgaaattgaagaagtgcaagggttcaaggacttgggattcacctttgacaagaaagacatagccccaagtgtggttagcatacttcctggtttgcaagaaaagaagcgcaatgaggatttaaacccggatatggtacgtcggccttatctttcggaggcatggatggtgcaaagctgtgctcctccacctccaaatttgggtgtaagtatgtctgctgaagacatgaaggcacaaatcaagttctgggctagagctgtggcatctaatgtgcgctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1685

Protein Analysis

132

Amino Acids

14.91

Weight (kDa)

6.34

Isoelectric Point (pI)

70.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 316
AcuI CTGAAG 1 cut(s) 360
AfaI GTAC 1 cut(s) 258
AfiI CCNNNNNNNGG 3 cut(s) 193, 253, 320
AgsI TTSAA 3 cut(s) 125, 131, 148
AhdI GACNNNNNGTC 1 cut(s) 38
AjnI CCWGG 1 cut(s) 208
AluBI AGCT 2 cut(s) 297, 377
AluI AGCT 2 cut(s) 297, 377
Alw21I GWGCWC 1 cut(s) 304
Alw26I GTCTC 1 cut(s) 79
AoxI GGCC 1 cut(s) 263
ApoI RAATTY 1 cut(s) 316
AspLEI GCGC 2 cut(s) 231, 396
AsuC2I CCSGG 1 cut(s) 248
AsuHPI GGTGA 1 cut(s) 154
BbsI GAAGAC 1 cut(s) 348
Bbv12I GWGCWC 1 cut(s) 304
BccI CCATC 1 cut(s) 280
BciT130I CCWGG 1 cut(s) 210
BcnI CCSGG 1 cut(s) 248
BcoDI GTCTC 1 cut(s) 79
BfaI CTAG 4 cut(s) 15, 102, 372, 397
Bme1390I CCNGG 2 cut(s) 210, 248
BmeRI GACNNNNNGTC 1 cut(s) 38
BmrFI CCNGG 2 cut(s) 210, 248
BmsI GCATC 1 cut(s) 392
BpiI GAAGAC 1 cut(s) 348
BpmI CTGGAG 1 cut(s) 21
Bpu10I CCTNAGC 1 cut(s) 113
BpuMI CCSGG 1 cut(s) 248
Bsc4I CCNNNNNNNGG 3 cut(s) 193, 253, 320
Bse1I ACTGG 1 cut(s) 38
Bse3DI GCAATG 1 cut(s) 238
BseBI CCWGG 1 cut(s) 210
BseGI GGATG 1 cut(s) 291
BseLI CCNNNNNNNGG 3 cut(s) 193, 253, 320
BseMI GCAATG 1 cut(s) 238
BseNI ACTGG 1 cut(s) 38
BseRI GAGGAG 1 cut(s) 294
BshFI GGCC 1 cut(s) 265
BsiHKAI GWGCWC 1 cut(s) 304
BsiSI CCGG 1 cut(s) 248
BslI CCNNNNNNNGG 3 cut(s) 193, 253, 320
BsmAI GTCTC 1 cut(s) 79
BsmBI CGTCTC 1 cut(s) 79
BsmI GAATGC 1 cut(s) 18
BsnI GGCC 1 cut(s) 265
Bsp1286I GDGCHC 1 cut(s) 304
BspANI GGCC 1 cut(s) 265
BsrDI GCAATG 1 cut(s) 238
BsrI ACTGG 1 cut(s) 38
Bst2UI CCWGG 1 cut(s) 210
BstDEI CTNAG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 291
BstHHI GCGC 2 cut(s) 231, 396
BstMAI GTCTC 1 cut(s) 79
BstNI CCWGG 1 cut(s) 210
BstSCI CCNGG 2 cut(s) 208, 246
BstV2I GAAGAC 1 cut(s) 348
BsuRI GGCC 1 cut(s) 265
BtsCI GGATG 1 cut(s) 291
CfoI GCGC 2 cut(s) 231, 396
CseI GACGC 1 cut(s) 96
Csp6I GTAC 1 cut(s) 257
CviAII CATG 2 cut(s) 282, 346
CviJI RGCY 6 cut(s) 111, 185, 265, 297, 371, 377
CviKI_1 RGCY 6 cut(s) 111, 185, 265, 297, 371, 377
CviQI GTAC 1 cut(s) 257
DdeI CTNAG 1 cut(s) 113
DraI TTTAAA 1 cut(s) 243
DriI GACNNNNNGTC 1 cut(s) 38
Eam1105I GACNNNNNGTC 1 cut(s) 38
Eco32I GATATC 1 cut(s) 29
Eco57I CTGAAG 1 cut(s) 360
EcoRII CCWGG 1 cut(s) 208
EcoRV GATATC 1 cut(s) 29
Esp3I CGTCTC 1 cut(s) 79
FaeI CATG 2 cut(s) 285, 349
FaiI YATR 6 cut(s) 182, 203, 254, 283, 332, 347
FatI CATG 2 cut(s) 281, 345
FokI GGATG 1 cut(s) 298
FspBI CTAG 4 cut(s) 15, 102, 372, 397
GlaI GCGC 2 cut(s) 230, 395
GsuI CTGGAG 1 cut(s) 21
HaeIII GGCC 1 cut(s) 265
HapII CCGG 1 cut(s) 248
HgaI GACGC 1 cut(s) 96
HhaI GCGC 2 cut(s) 231, 396
Hin1II CATG 2 cut(s) 285, 349
Hin6I GCGC 2 cut(s) 229, 394
HinP1I GCGC 2 cut(s) 229, 394
HinfI GANTC 1 cut(s) 159
HpaII CCGG 1 cut(s) 248
HphI GGTGA 1 cut(s) 154
Hpy188I TCNGA 2 cut(s) 44, 277
Hpy188III TCNNGA 1 cut(s) 102
Hpy99I CGWCG 1 cut(s) 264
HpyAV CCTTC 2 cut(s) 47, 343
HpyCH4IV ACGT 1 cut(s) 259
HpyCH4V TGCA 4 cut(s) 65, 139, 217, 292
HpyF3I CTNAG 1 cut(s) 113
HpySE526I ACGT 1 cut(s) 259
Hsp92II CATG 2 cut(s) 285, 349
HspAI GCGC 2 cut(s) 229, 394
LmnI GCTCC 1 cut(s) 307
LpnPI CCDG 5 cut(s) 51, 195, 222, 261, 352
LweI GCATC 1 cut(s) 392
MaeI CTAG 4 cut(s) 15, 102, 372, 397
MaeII ACGT 1 cut(s) 259
MboII GAAGA 2 cut(s) 143, 353
MhlI GDGCHC 1 cut(s) 304
MluCI AATT 3 cut(s) 91, 126, 316
MnlI CCTC 6 cut(s) 45, 70, 229, 271, 315, 321
MseI TTAA 1 cut(s) 242
MspI CCGG 1 cut(s) 248
MspR9I CCNGG 2 cut(s) 210, 248
Mva1269I GAATGC 1 cut(s) 18
MvaI CCWGG 1 cut(s) 210
NciI CCSGG 1 cut(s) 248
NlaIII CATG 2 cut(s) 285, 349
PctI GAATGC 1 cut(s) 18
PfeI GAWTC 1 cut(s) 159
Psp6I CCWGG 1 cut(s) 208
PspGI CCWGG 1 cut(s) 208
RsaI GTAC 1 cut(s) 258
RsaNI GTAC 1 cut(s) 257
SaqAI TTAA 1 cut(s) 242
ScrFI CCNGG 2 cut(s) 210, 248
SduI GDGCHC 1 cut(s) 304
SetI ASST 7 cut(s) 37, 123, 167, 262, 299, 313, 379
SfaNI GCATC 1 cut(s) 392
Sse9I AATT 3 cut(s) 91, 126, 316
SspMI CTAG 4 cut(s) 15, 102, 372, 397
StyD4I CCNGG 2 cut(s) 208, 246
TaiI ACGT 1 cut(s) 262
TaqI TCGA 1 cut(s) 31
TasI AATT 3 cut(s) 91, 126, 316
TfiI GAWTC 1 cut(s) 159
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TspDTI ATGAA 1 cut(s) 362
XapI RAATTY 1 cut(s) 316
XbaI TCTAGA 1 cut(s) 101
XspI CTAG 4 cut(s) 15, 102, 372, 397
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.