Rh5AG444800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
76318601 .. 76333416
14816 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG444800.1

Sequence Viewer

Length: 192 bp
ATGTTTTCGAATCTAAAATTGGGATATATTGACAAGCCGTATTGGAAAATAATACCACTCAAATTATCATCTGCTGTAAGCAAAATAGAAGAAGTTGAAGATAGAGAGAAGAGTGATAGTAGAAGAAGCAAATCAAATGGGCAATCAGTGCAGCGTAGTAACTTGGGGCTTGACCTTTGGTTGTCCTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.23

Weight (kDa)

9.45

Isoelectric Point (pI)

55.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 98
AjuI GAANNNNNNNTTGG 1 cut(s) 34
ApeKI GCWGC 1 cut(s) 151
AsuII TTCGAA 1 cut(s) 8
BbvI GCAGC 1 cut(s) 163
BceAI ACGGC 1 cut(s) 22
BisI GCNGC 1 cut(s) 152
BlsI GCNGC 1 cut(s) 153
Bpu14I TTCGAA 1 cut(s) 8
BseXI GCAGC 1 cut(s) 163
BsgI GTGCAG 1 cut(s) 170
Bsp119I TTCGAA 1 cut(s) 8
BspT104I TTCGAA 1 cut(s) 8
Bst6I CTCTTC 1 cut(s) 104
BstAPI GCANNNNNTGC 1 cut(s) 148
BstBI TTCGAA 1 cut(s) 8
BstDEI CTNAG 1 cut(s) 189
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstV1I GCAGC 1 cut(s) 163
BtsIMutI CAGTG 1 cut(s) 153
CviJI RGCY 2 cut(s) 37, 169
CviKI_1 RGCY 2 cut(s) 37, 169
DdeI CTNAG 1 cut(s) 189
Eam1104I CTCTTC 1 cut(s) 104
EarI CTCTTC 1 cut(s) 104
FaiI YATR 1 cut(s) 27
Fnu4HI GCNGC 1 cut(s) 152
Fsp4HI GCNGC 1 cut(s) 152
GluI GCNGC 1 cut(s) 152
HinfI GANTC 1 cut(s) 10
HpyCH4V TGCA 1 cut(s) 151
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
HpyF3I CTNAG 1 cut(s) 189
Lsp1109I GCAGC 1 cut(s) 163
MaeIII GTNAC 1 cut(s) 158
MboII GAAGA 4 cut(s) 101, 110, 121, 135
MluCI AATT 2 cut(s) 17, 62
MwoI GCNNNNNNNGC 1 cut(s) 148
NspV TTCGAA 1 cut(s) 8
PfeI GAWTC 1 cut(s) 10
PkrI GCNGC 1 cut(s) 153
SatI GCNGC 1 cut(s) 152
SetI ASST 1 cut(s) 177
SfuI TTCGAA 1 cut(s) 8
SgeI CNNG 3 cut(s) 46, 175, 182
Sse9I AATT 2 cut(s) 17, 62
TaqI TCGA 1 cut(s) 8
TasI AATT 2 cut(s) 17, 62
TfiI GAWTC 1 cut(s) 10
TscAI CASTG 1 cut(s) 153
TseI GCWGC 1 cut(s) 151
TspRI CASTG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.