Rmu_sc0042408.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042408.1
OG0007116
Physical Location & Seq
Forward (+)
1 .. 600
600 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042408.1_g000001.1.cds

Sequence Viewer

Length: 402 bp
ggcatgacacaatgctctagcattccaagatatcgacctccagtcagaagcacagaaggggaaaatgcagatgttagcaaggaaatgagacgcaatttactttctagaaagagcctaagcgaccttgaaattgaagaagtgcaagggttcaaggacttgggattcacctttgacaagaaagacatagccccaagtgtggttagcatacttcctggtttgcaagaaaagaagcgcaatgaggatttaaacccggatatggtacgtcggccttatctttcggaggcatggatggtgcaaagctgtgctcctccacctccaaatttgggtgtaagtatgtctgctgaagacatgaaggcacaaatcaagttctgggctagagctgtggcatctaatgtgcgctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1685

Protein Analysis

133

Amino Acids

14.97

Weight (kDa)

8.64

Isoelectric Point (pI)

65.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 319
AcuI CTGAAG 1 cut(s) 363
AfaI GTAC 1 cut(s) 261
AfiI CCNNNNNNNGG 3 cut(s) 196, 256, 323
AgsI TTSAA 3 cut(s) 128, 134, 151
AhdI GACNNNNNGTC 1 cut(s) 41
AjnI CCWGG 1 cut(s) 211
AluBI AGCT 2 cut(s) 300, 380
AluI AGCT 2 cut(s) 300, 380
Alw21I GWGCWC 1 cut(s) 307
Alw26I GTCTC 1 cut(s) 82
AoxI GGCC 1 cut(s) 266
ApoI RAATTY 1 cut(s) 319
AspLEI GCGC 2 cut(s) 234, 399
AsuC2I CCSGG 1 cut(s) 251
AsuHPI GGTGA 1 cut(s) 157
BbsI GAAGAC 1 cut(s) 351
Bbv12I GWGCWC 1 cut(s) 307
BccI CCATC 1 cut(s) 283
BciT130I CCWGG 1 cut(s) 213
BcnI CCSGG 1 cut(s) 251
BcoDI GTCTC 1 cut(s) 82
BfaI CTAG 4 cut(s) 18, 105, 375, 400
Bme1390I CCNGG 2 cut(s) 213, 251
BmeRI GACNNNNNGTC 1 cut(s) 41
BmrFI CCNGG 2 cut(s) 213, 251
BmsI GCATC 1 cut(s) 395
BpiI GAAGAC 1 cut(s) 351
BpmI CTGGAG 1 cut(s) 24
Bpu10I CCTNAGC 1 cut(s) 116
BpuMI CCSGG 1 cut(s) 251
Bsc4I CCNNNNNNNGG 3 cut(s) 196, 256, 323
Bse1I ACTGG 1 cut(s) 41
Bse3DI GCAATG 1 cut(s) 241
BseBI CCWGG 1 cut(s) 213
BseGI GGATG 1 cut(s) 294
BseLI CCNNNNNNNGG 3 cut(s) 196, 256, 323
BseMI GCAATG 1 cut(s) 241
BseNI ACTGG 1 cut(s) 41
BseRI GAGGAG 1 cut(s) 297
BshFI GGCC 1 cut(s) 268
BsiHKAI GWGCWC 1 cut(s) 307
BsiSI CCGG 1 cut(s) 251
BslI CCNNNNNNNGG 3 cut(s) 196, 256, 323
BsmAI GTCTC 1 cut(s) 82
BsmBI CGTCTC 1 cut(s) 82
BsmI GAATGC 1 cut(s) 21
BsnI GGCC 1 cut(s) 268
Bsp1286I GDGCHC 1 cut(s) 307
BspANI GGCC 1 cut(s) 268
BsrDI GCAATG 1 cut(s) 241
BsrI ACTGG 1 cut(s) 41
Bst2UI CCWGG 1 cut(s) 213
BstDEI CTNAG 1 cut(s) 116
BstF5I GGATG 1 cut(s) 294
BstHHI GCGC 2 cut(s) 234, 399
BstMAI GTCTC 1 cut(s) 82
BstNI CCWGG 1 cut(s) 213
BstSCI CCNGG 2 cut(s) 211, 249
BstV2I GAAGAC 1 cut(s) 351
BsuRI GGCC 1 cut(s) 268
BtsCI GGATG 1 cut(s) 294
CfoI GCGC 2 cut(s) 234, 399
CseI GACGC 1 cut(s) 99
Csp6I GTAC 1 cut(s) 260
CviAII CATG 3 cut(s) 4, 285, 349
CviJI RGCY 6 cut(s) 114, 188, 268, 300, 374, 380
CviKI_1 RGCY 6 cut(s) 114, 188, 268, 300, 374, 380
CviQI GTAC 1 cut(s) 260
DdeI CTNAG 1 cut(s) 116
DraI TTTAAA 1 cut(s) 246
DriI GACNNNNNGTC 1 cut(s) 41
Eam1105I GACNNNNNGTC 1 cut(s) 41
Eco32I GATATC 1 cut(s) 32
Eco57I CTGAAG 1 cut(s) 363
EcoRII CCWGG 1 cut(s) 211
EcoRV GATATC 1 cut(s) 32
Esp3I CGTCTC 1 cut(s) 82
FaeI CATG 3 cut(s) 7, 288, 352
FaiI YATR 7 cut(s) 5, 185, 206, 257, 286, 335, 350
FatI CATG 3 cut(s) 3, 284, 348
FokI GGATG 1 cut(s) 301
FspBI CTAG 4 cut(s) 18, 105, 375, 400
GlaI GCGC 2 cut(s) 233, 398
GsuI CTGGAG 1 cut(s) 24
HaeIII GGCC 1 cut(s) 268
HapII CCGG 1 cut(s) 251
HgaI GACGC 1 cut(s) 99
HhaI GCGC 2 cut(s) 234, 399
Hin1II CATG 3 cut(s) 7, 288, 352
Hin6I GCGC 2 cut(s) 232, 397
HinP1I GCGC 2 cut(s) 232, 397
HinfI GANTC 1 cut(s) 162
HpaII CCGG 1 cut(s) 251
HphI GGTGA 1 cut(s) 157
Hpy188I TCNGA 2 cut(s) 47, 280
Hpy188III TCNNGA 1 cut(s) 105
Hpy99I CGWCG 1 cut(s) 267
HpyAV CCTTC 2 cut(s) 50, 346
HpyCH4IV ACGT 1 cut(s) 262
HpyCH4V TGCA 4 cut(s) 68, 142, 220, 295
HpyF3I CTNAG 1 cut(s) 116
HpySE526I ACGT 1 cut(s) 262
Hsp92II CATG 3 cut(s) 7, 288, 352
HspAI GCGC 2 cut(s) 232, 397
LmnI GCTCC 1 cut(s) 310
LpnPI CCDG 5 cut(s) 54, 198, 225, 264, 355
LweI GCATC 1 cut(s) 395
MaeI CTAG 4 cut(s) 18, 105, 375, 400
MaeII ACGT 1 cut(s) 262
MboII GAAGA 2 cut(s) 146, 356
MhlI GDGCHC 1 cut(s) 307
MluCI AATT 3 cut(s) 94, 129, 319
MnlI CCTC 5 cut(s) 48, 232, 274, 318, 324
MseI TTAA 1 cut(s) 245
MspI CCGG 1 cut(s) 251
MspR9I CCNGG 2 cut(s) 213, 251
Mva1269I GAATGC 1 cut(s) 21
MvaI CCWGG 1 cut(s) 213
NciI CCSGG 1 cut(s) 251
NlaIII CATG 3 cut(s) 7, 288, 352
PctI GAATGC 1 cut(s) 21
PfeI GAWTC 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 211
PspGI CCWGG 1 cut(s) 211
RsaI GTAC 1 cut(s) 261
RsaNI GTAC 1 cut(s) 260
SaqAI TTAA 1 cut(s) 245
ScrFI CCNGG 2 cut(s) 213, 251
SduI GDGCHC 1 cut(s) 307
SetI ASST 7 cut(s) 40, 126, 170, 265, 302, 316, 382
SfaNI GCATC 1 cut(s) 395
Sse9I AATT 3 cut(s) 94, 129, 319
SspMI CTAG 4 cut(s) 18, 105, 375, 400
StyD4I CCNGG 2 cut(s) 211, 249
TaiI ACGT 1 cut(s) 265
TaqI TCGA 1 cut(s) 34
TasI AATT 3 cut(s) 94, 129, 319
TfiI GAWTC 1 cut(s) 162
Tru1I TTAA 1 cut(s) 245
Tru9I TTAA 1 cut(s) 245
TspDTI ATGAA 1 cut(s) 365
XapI RAATTY 1 cut(s) 319
XbaI TCTAGA 1 cut(s) 104
XspI CTAG 4 cut(s) 18, 105, 375, 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.