Rmu_sc0018801.1_g000001

ACT domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018801.1
Physical Location & Seq
Reverse (-)
1 .. 901
901 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018801.1_g000001.1.cds

Sequence Viewer

Length: 276 bp
atggatgatgagtatgctaagttcgtgaggcggatgaacccacccagagttgtgattgacaatgattcttgtgaggatgctactattatccaggttgacagtttcaacaaacatggaattctcctagatgttgtccaagtgcttgcagatgtgaaccttgtcataacaaaagcttatatctcatctgatggagtatggttcatggatgtgttcaacgtgattgaccgtgacggcaaaaaaatcagagacaaggacattatcaattatatacaaatt

Protein Analysis

92

Amino Acids

10.61

Weight (kDa)

4.59

Isoelectric Point (pI)

26.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 31
AcsI RAATTY 1 cut(s) 117
AgsI TTSAA 2 cut(s) 106, 214
AjnI CCWGG 1 cut(s) 90
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
Alw26I GTCTC 1 cut(s) 240
ApoI RAATTY 1 cut(s) 117
BccI CCATC 1 cut(s) 182
BceAI ACGGC 1 cut(s) 247
BciT130I CCWGG 1 cut(s) 92
BcoDI GTCTC 1 cut(s) 240
BfaI CTAG 1 cut(s) 125
Bme1390I CCNGG 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 92
BmsI GCATC 1 cut(s) 67
BseBI CCWGG 1 cut(s) 92
BseGI GGATG 4 cut(s) 10, 39, 82, 211
BsmAI GTCTC 1 cut(s) 240
BspACI CCGC 1 cut(s) 31
Bst2UI CCWGG 1 cut(s) 92
Bst4CI ACNGT 2 cut(s) 101, 227
BstC8I GCNNGC 1 cut(s) 144
BstDEI CTNAG 1 cut(s) 18
BstF5I GGATG 4 cut(s) 10, 39, 82, 211
BstMAI GTCTC 1 cut(s) 240
BstNI CCWGG 1 cut(s) 92
BstSCI CCNGG 1 cut(s) 90
BtsCI GGATG 4 cut(s) 10, 39, 82, 211
Cac8I GCNNGC 1 cut(s) 144
CviAII CATG 2 cut(s) 113, 202
CviJI RGCY 1 cut(s) 173
CviKI_1 RGCY 1 cut(s) 173
DdeI CTNAG 1 cut(s) 18
EciI GGCGGA 1 cut(s) 46
EcoRI GAATTC 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 90
FaeI CATG 2 cut(s) 116, 205
FaiI YATR 8 cut(s) 15, 114, 164, 177, 196, 203, 267, 269
FatI CATG 2 cut(s) 112, 201
FokI GGATG 4 cut(s) 17, 46, 89, 218
FspBI CTAG 1 cut(s) 125
Hin1II CATG 2 cut(s) 116, 205
HincII GTYRAC 1 cut(s) 97
HindII GTYRAC 1 cut(s) 97
HindIII AAGCTT 1 cut(s) 171
HinfI GANTC 1 cut(s) 65
Hpy166II GTNNAC 2 cut(s) 97, 154
Hpy188I TCNGA 2 cut(s) 187, 245
Hpy188III TCNNGA 1 cut(s) 25
Hpy8I GTNNAC 2 cut(s) 97, 154
HpyCH4III ACNGT 2 cut(s) 101, 227
HpyCH4IV ACGT 1 cut(s) 216
HpyCH4V TGCA 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 18
HpySE526I ACGT 1 cut(s) 216
Hsp92II CATG 2 cut(s) 116, 205
LpnPI CCDG 3 cut(s) 58, 77, 104
LweI GCATC 1 cut(s) 67
MaeI CTAG 1 cut(s) 125
MaeII ACGT 1 cut(s) 216
MaeIII GTNAC 1 cut(s) 227
MluCI AATT 2 cut(s) 117, 262
MnlI CCTC 2 cut(s) 21, 67
MslI CAYNNNNRTG 1 cut(s) 206
MspR9I CCNGG 1 cut(s) 92
MvaI CCWGG 1 cut(s) 92
NlaIII CATG 2 cut(s) 116, 205
NmuCI GTSAC 1 cut(s) 227
PfeI GAWTC 1 cut(s) 65
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
PsrI GAACNNNNNNTAC 1 cut(s) 37
RseI CAYNNNNRTG 1 cut(s) 206
ScrFI CCNGG 1 cut(s) 92
SetI ASST 4 cut(s) 96, 159, 175, 219
SfaNI GCATC 1 cut(s) 67
SmiMI CAYNNNNRTG 1 cut(s) 206
Sse9I AATT 2 cut(s) 117, 262
SsiI CCGC 1 cut(s) 31
SspMI CTAG 1 cut(s) 125
StyD4I CCNGG 1 cut(s) 90
TaaI ACNGT 2 cut(s) 101, 227
TaiI ACGT 1 cut(s) 219
TasI AATT 2 cut(s) 117, 262
TfiI GAWTC 1 cut(s) 65
TseFI GTSAC 1 cut(s) 227
Tsp45I GTSAC 1 cut(s) 227
TspDTI ATGAA 2 cut(s) 50, 190
XapI RAATTY 1 cut(s) 117
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.