Rmu_sc0019329.1_g000002

UPF0496 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019329.1
OG0010852
Physical Location & Seq
Reverse (-)
14684 .. 15874
1191 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019329.1_g000002.1.cds

Sequence Viewer

Length: 1191 bp
atgcccgcgacggaattccaaaggtcgtcggcagctgggttcaaccaattcgggcgctcctccgtcttcagcctcagacgccgcccccaccaccaccaccaccacaacctcgtcaatccagtcatggacggcgcccaagctctcgacctcgacaccttccagacccacgtcgccgattgcttccaacacctctcctccccctcccaagacctcctctccctctcctggctccgcgacctcctcgacggcttcctccgcattcaccaccagttcaagctcctcctcctctccaccccaaaatccaacgtcagcaggcccgccgtcgaccgcctcctctccgattacttcgagcgcagcgtcaaggccctcgacgtctgcaatgcgattcgcgacgggattgagcagatgaggcagtggcagaagctcttggagattgtgctctgcgctctcgaccgggaccggactctcggcgaaggccagttccggcgagccaagaaggccctgatagatttggctattgcaatgctagacgacaaggacagctccaacaacaccaccctcgcccaccgcaaccggtcctttggccggagcaacgccccggccaaagactaccggtcgatgggccacttccgatctctgtcgtggagcgtctcgcggtcgtggtcggcggcgaggcagctacaggcgattgggaacaacctctgcgcgccgaggcccaatgaagtcgtggcgaccaatgggctggcgtcggctgtgttcaccatcaattctgttctactgttcgtaatgttggcgctggtggcggcgattccgtgccaggaccgcggcctccaggtccacttcacgattccgaggaccttcgggtgggcggcgccgctgctttcgctgcacgagaggatactggaggagtcgaagcggcgggaccggaggaacgcctgcgcgcttttgaaggagattcatcagatcgagaaatgttcccgggtcataagcgaattggctgattcggttcagtttccgttgagtgaggagaaagaaggggaggtcaggcagagagttcaggagctttcgcagctctgcgagggcataaaggaggggttggaccctctggaaagacaggtcagggaggtcttccatggaattgtgcggagcagaacagaggggatcgactctttgggaaagaccaatgaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BPS1

Protein Analysis

396

Amino Acids

44.81

Weight (kDa)

8.94

Isoelectric Point (pI)

49.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010852)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G18740 AT1G74450
fragaria_vesca FvH4_2g13680 FvH4_2g13680
malus_domestica MD05G1026700.v1.1 MD10G1025900.v1.1
prunus_persica Prupe.8G031200_v2.0.a1
pyrus_communis pycom05g01850 pycom10g01740
rosa_chinensis RchiOBHm_Chr6g0275361
rosa_laevigata RLG00000013471
rosa_multiflora Rmu_co8417379.1_g000001 Rmu_sc0004143.1_g000001 Rmu_sc0019329.1_g000002
rosa_roxburghii Rroxscaffold_7G00193380
rosa_rugosa Rorug06G0091100
rosa_samantha Rh6AG205000 Rh6CG210200 Rh6DG200500
rosa_wichuraiana Rw6G017790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 375
AccB1I GGYRCC 2 cut(s) 131, 871
AccI GTMKAC 1 cut(s) 324
AccII CGCG 7 cut(s) 8, 234, 390, 655, 707, 825, 941
AclWI GGATC 1 cut(s) 1169
AcoI YGGCCR 2 cut(s) 583, 600
AcsI RAATTY 1 cut(s) 14
AcuI CTGAAG 1 cut(s) 52
AcyI GRCGYC 5 cut(s) 79, 132, 372, 746, 872
AfiI CCNNNNNNNGG 4 cut(s) 225, 585, 619, 864
AgeI ACCGGT 2 cut(s) 573, 612
AgsI TTSAA 3 cut(s) 43, 274, 949
AhdI GACNNNNNGTC 1 cut(s) 613
AjiI CACGTC 1 cut(s) 169
AjnI CCWGG 3 cut(s) 224, 816, 831
AluBI AGCT 8 cut(s) 35, 140, 277, 424, 543, 679, 1063, 1072
AluI AGCT 8 cut(s) 35, 140, 277, 424, 543, 679, 1063, 1072
Alw21I GWGCWC 1 cut(s) 441
Alw26I GTCTC 1 cut(s) 655
AlwI GGATC 1 cut(s) 1169
Ama87I CYCGRG 1 cut(s) 978
AoxI GGCC 9 cut(s) 314, 363, 475, 498, 583, 600, 622, 713, 826
ApeKI GCWGC 6 cut(s) 32, 354, 676, 877, 886, 1069
ApoI RAATTY 1 cut(s) 14
AsiGI ACCGGT 2 cut(s) 573, 612
AsuC2I CCSGG 4 cut(s) 455, 599, 979, 980
AsuHPI GGTGA 2 cut(s) 254, 751
AvaI CYCGRG 1 cut(s) 978
AvaII GGWCC 7 cut(s) 457, 576, 820, 835, 855, 922, 1099
BanI GGYRCC 2 cut(s) 131, 871
BauI CACGAG 1 cut(s) 890
BbsI GAAGAC 2 cut(s) 58, 1120
Bbv12I GWGCWC 1 cut(s) 441
BbvI GCAGC 6 cut(s) 44, 366, 688, 864, 873, 1081
BccI CCATC 2 cut(s) 613, 770
BceAI ACGGC 3 cut(s) 145, 262, 305
BciT130I CCWGG 3 cut(s) 226, 818, 833
BciVI GTATCC 1 cut(s) 891
BcnI CCSGG 4 cut(s) 455, 599, 979, 980
BcoDI GTCTC 1 cut(s) 655
BfaI CTAG 1 cut(s) 527
BfmI CTRYAG 1 cut(s) 680
BfoI RGCGCY 4 cut(s) 58, 135, 797, 875
BfuI GTATCC 1 cut(s) 891
BglI GCCNNNNNGGC 1 cut(s) 497
Bme1390I CCNGG 7 cut(s) 226, 455, 599, 818, 833, 979, 980
Bme18I GGWCC 7 cut(s) 457, 576, 820, 835, 855, 922, 1099
BmeRI GACNNNNNGTC 1 cut(s) 613
BmeT110I CYCGRG 1 cut(s) 978
BmgBI CACGTC 1 cut(s) 169
BmiI GGNNCC 6 cut(s) 133, 230, 458, 873, 923, 1101
BmrFI CCNGG 7 cut(s) 226, 455, 599, 818, 833, 979, 980
BoxI GACNNNNGTC 1 cut(s) 167
BpiI GAAGAC 2 cut(s) 58, 1120
BpmI CTGGAG 2 cut(s) 815, 923
BpuMI CCSGG 4 cut(s) 455, 599, 979, 980
BsaHI GRCGYC 5 cut(s) 79, 132, 372, 746, 872
BsaJI CCNNGG 6 cut(s) 597, 710, 823, 851, 978, 1132
BsaWI WCCGGW 4 cut(s) 459, 573, 612, 924
BsaXI ACNNNNNCTCC 4 cut(s) 179, 200, 209, 230
Bsc4I CCNNNNNNNGG 4 cut(s) 225, 585, 619, 864
Bse118I RCCGGY 2 cut(s) 573, 612
Bse1I ACTGG 4 cut(s) 119, 268, 478, 906
Bse3DI GCAATG 2 cut(s) 385, 528
BseBI CCWGG 3 cut(s) 226, 818, 833
BseDI CCNNGG 6 cut(s) 597, 710, 823, 851, 978, 1132
BseLI CCNNNNNNNGG 4 cut(s) 225, 585, 619, 864
BseMI GCAATG 2 cut(s) 385, 528
BseMII CTCAG 1 cut(s) 88
BseNI ACTGG 4 cut(s) 119, 268, 478, 906
BsePI GCGCGC 2 cut(s) 705, 939
BseXI GCAGC 6 cut(s) 44, 366, 688, 864, 873, 1081
BseYI CCCAGC 1 cut(s) 35
BsgI GTGCAG 1 cut(s) 872
Bsh1236I CGCG 7 cut(s) 8, 234, 390, 655, 707, 825, 941
Bsh1285I CGRYCG 4 cut(s) 328, 454, 617, 659
BshFI GGCC 9 cut(s) 316, 365, 477, 500, 585, 602, 624, 715, 828
BshNI GGYRCC 2 cut(s) 131, 871
BshTI ACCGGT 2 cut(s) 573, 612
BsiEI CGRYCG 4 cut(s) 328, 454, 617, 659
BsiHKAI GWGCWC 1 cut(s) 441
BsiHKCI CYCGRG 1 cut(s) 978
BsiSI CCGG 9 cut(s) 454, 460, 484, 574, 586, 599, 613, 925, 979
BslFI GGGAC 2 cut(s) 470, 935
BslI CCNNNNNNNGG 4 cut(s) 225, 585, 619, 864
BsmAI GTCTC 1 cut(s) 655
BsmBI CGTCTC 1 cut(s) 655
BsmFI GGGAC 2 cut(s) 470, 935
BsmI GAATGC 1 cut(s) 258
BsnI GGCC 9 cut(s) 316, 365, 477, 500, 585, 602, 624, 715, 828
BsoBI CYCGRG 1 cut(s) 978
Bsp1286I GDGCHC 1 cut(s) 441
Bsp143I GATC 3 cut(s) 632, 963, 1161
Bsp19I CCATGG 1 cut(s) 1132
Bsp68I TCGCGA 1 cut(s) 390
BspANI GGCC 9 cut(s) 316, 365, 477, 500, 585, 602, 624, 715, 828
BspCNI CTCAG 1 cut(s) 87
BspFNI CGCG 7 cut(s) 8, 234, 390, 655, 707, 825, 941
BspLI GGNNCC 6 cut(s) 133, 230, 458, 873, 923, 1101
BspPI GGATC 1 cut(s) 1169
BspT107I GGYRCC 2 cut(s) 131, 871
BsrDI GCAATG 2 cut(s) 385, 528
BsrFI RCCGGY 2 cut(s) 573, 612
BsrI ACTGG 4 cut(s) 119, 268, 478, 906
BssAI RCCGGY 2 cut(s) 573, 612
BssECI CCNNGG 6 cut(s) 597, 710, 823, 851, 978, 1132
BssHII GCGCGC 2 cut(s) 705, 939
BssMI GATC 3 cut(s) 632, 963, 1161
BssNI GRCGYC 5 cut(s) 79, 132, 372, 746, 872
BssSI CACGAG 1 cut(s) 890
BssT1I CCWWGG 1 cut(s) 1132
Bst2BI CACGAG 1 cut(s) 890
Bst2UI CCWGG 3 cut(s) 226, 818, 833
Bst4CI ACNGT 1 cut(s) 780
BstACI GRCGYC 5 cut(s) 79, 132, 372, 746, 872
BstC8I GCNNGC 8 cut(s) 6, 314, 318, 489, 707, 744, 937, 941
BstDEI CTNAG 1 cut(s) 74
BstDSI CCRYGG 2 cut(s) 823, 1132
BstFNI CGCG 7 cut(s) 8, 234, 390, 655, 707, 825, 941
BstH2I RGCGCY 4 cut(s) 58, 135, 797, 875
BstKTI GATC 3 cut(s) 635, 966, 1164
BstMAI GTCTC 1 cut(s) 655
BstMBI GATC 3 cut(s) 632, 963, 1161
BstMCI CGRYCG 4 cut(s) 328, 454, 617, 659
BstMWI GCNNNNNNNGC 9 cut(s) 78, 255, 409, 497, 800, 822, 883, 886, 1069
BstNI CCWGG 3 cut(s) 226, 818, 833
BstPAI GACNNNNGTC 1 cut(s) 167
BstSCI CCNGG 7 cut(s) 224, 453, 597, 816, 831, 977, 978
BstSFI CTRYAG 1 cut(s) 680
BstUI CGCG 7 cut(s) 8, 234, 390, 655, 707, 825, 941
BstV1I GCAGC 6 cut(s) 44, 366, 688, 864, 873, 1081
BstV2I GAAGAC 2 cut(s) 58, 1120
BstXI CCANNNNNNTGG 1 cut(s) 742
BsuI GTATCC 1 cut(s) 891
BsuRI GGCC 9 cut(s) 316, 365, 477, 500, 585, 602, 624, 715, 828
BtgI CCRYGG 2 cut(s) 823, 1132
BtrI CACGTC 1 cut(s) 169
BtsI GCAGTG 1 cut(s) 419
BtsIMutI CAGTG 1 cut(s) 419
BtuMI TCGCGA 1 cut(s) 390
Cac8I GCNNGC 8 cut(s) 6, 314, 318, 489, 707, 744, 937, 941
Cfr10I RCCGGY 2 cut(s) 573, 612
Cfr42I CCGCGG 1 cut(s) 826
Cfr9I CCCGGG 1 cut(s) 978
CseI GACGC 4 cut(s) 87, 346, 637, 735
CspAI ACCGGT 2 cut(s) 573, 612
CviAII CATG 2 cut(s) 124, 1133
DdeI CTNAG 1 cut(s) 74
DinI GGCGCC 2 cut(s) 133, 873
DpnI GATC 3 cut(s) 634, 965, 1163
DpnII GATC 3 cut(s) 632, 963, 1161
DriI GACNNNNNGTC 1 cut(s) 613
EaeI YGGCCR 2 cut(s) 583, 600
Eam1105I GACNNNNNGTC 1 cut(s) 613
Eco130I CCWWGG 1 cut(s) 1132
Eco47I GGWCC 7 cut(s) 457, 576, 820, 835, 855, 922, 1099
Eco57I CTGAAG 1 cut(s) 52
Eco88I CYCGRG 1 cut(s) 978
EcoO109I RGGNCCY 3 cut(s) 364, 499, 855
EcoRI GAATTC 1 cut(s) 14
EcoRII CCWGG 3 cut(s) 224, 816, 831
EcoT14I CCWWGG 1 cut(s) 1132
EgeI GGCGCC 2 cut(s) 133, 873
EheI GGCGCC 2 cut(s) 133, 873
ErhI CCWWGG 1 cut(s) 1132
Esp3I CGTCTC 1 cut(s) 655
FaeI CATG 2 cut(s) 127, 1136
FaiI YATR 4 cut(s) 125, 986, 1085, 1134
FaqI GGGAC 2 cut(s) 470, 935
FatI CATG 2 cut(s) 123, 1132
FauI CCCGC 3 cut(s) 13, 325, 912
FblI GTMKAC 1 cut(s) 324
FspBI CTAG 1 cut(s) 527
GsaI CCCAGC 1 cut(s) 39
GsuI CTGGAG 2 cut(s) 815, 923
HaeII RGCGCY 4 cut(s) 58, 135, 797, 875
HaeIII GGCC 9 cut(s) 316, 365, 477, 500, 585, 602, 624, 715, 828
HapII CCGG 9 cut(s) 454, 460, 484, 574, 586, 599, 613, 925, 979
HgaI GACGC 4 cut(s) 87, 346, 637, 735
Hin1I GRCGYC 5 cut(s) 79, 132, 372, 746, 872
Hin1II CATG 2 cut(s) 127, 1136
HincII GTYRAC 1 cut(s) 325
HindII GTYRAC 1 cut(s) 325
HinfI GANTC 8 cut(s) 385, 463, 808, 847, 908, 955, 1001, 1166
HpaII CCGG 9 cut(s) 454, 460, 484, 574, 586, 599, 613, 925, 979
HphI GGTGA 2 cut(s) 254, 751
Hpy166II GTNNAC 3 cut(s) 325, 759, 838
Hpy188I TCNGA 5 cut(s) 77, 340, 632, 852, 963
Hpy188III TCNNGA 8 cut(s) 143, 160, 389, 449, 844, 967, 1058, 1106
Hpy8I GTNNAC 3 cut(s) 325, 759, 838
Hpy99I CGWCG 8 cut(s) 13, 31, 173, 248, 326, 374, 395, 751
HpyAV CCTTC 6 cut(s) 166, 467, 490, 868, 943, 1028
HpyCH4III ACNGT 1 cut(s) 780
HpyCH4IV ACGT 3 cut(s) 168, 306, 372
HpyCH4V TGCA 3 cut(s) 378, 521, 889
HpyF10VI GCNNNNNNNGC 9 cut(s) 78, 255, 409, 497, 800, 822, 883, 886, 1069
HpyF3I CTNAG 1 cut(s) 74
HpySE526I ACGT 3 cut(s) 168, 306, 372
Hsp92I GRCGYC 5 cut(s) 79, 132, 372, 746, 872
Hsp92II CATG 2 cut(s) 127, 1136
KasI GGCGCC 2 cut(s) 131, 871
KspI CCGCGG 1 cut(s) 826
Kzo9I GATC 3 cut(s) 632, 963, 1161
LmnI GCTCC 8 cut(s) 62, 234, 282, 548, 588, 645, 1060, 1146
Lsp1109I GCAGC 6 cut(s) 44, 366, 688, 864, 873, 1081
MaeI CTAG 1 cut(s) 527
MaeII ACGT 3 cut(s) 168, 306, 372
MalI GATC 3 cut(s) 634, 965, 1163
MboI GATC 3 cut(s) 632, 963, 1161
MboII GAAGA 2 cut(s) 58, 1120
MhlI GDGCHC 1 cut(s) 441
MluCI AATT 5 cut(s) 14, 47, 766, 992, 1137
Mly113I GGCGCC 2 cut(s) 132, 872
MlyI GAGTC 3 cut(s) 457, 917, 1160
MmeI TCCRAC 4 cut(s) 208, 327, 570, 1077
MspA1I CMGCKG 3 cut(s) 35, 825, 877
MspI CCGG 9 cut(s) 454, 460, 484, 574, 586, 599, 613, 925, 979
MspR9I CCNGG 7 cut(s) 226, 455, 599, 818, 833, 979, 980
Mva1269I GAATGC 1 cut(s) 258
MvaI CCWGG 3 cut(s) 226, 818, 833
MvnI CGCG 7 cut(s) 8, 234, 390, 655, 707, 825, 941
MwoI GCNNNNNNNGC 9 cut(s) 78, 255, 409, 497, 800, 822, 883, 886, 1069
NarI GGCGCC 2 cut(s) 132, 872
NciI CCSGG 4 cut(s) 455, 599, 979, 980
NcoI CCATGG 1 cut(s) 1132
NdeII GATC 3 cut(s) 632, 963, 1161
NlaIII CATG 2 cut(s) 127, 1136
NlaIV GGNNCC 6 cut(s) 133, 230, 458, 873, 923, 1101
NmeAIII GCCGAG 2 cut(s) 447, 735
NruI TCGCGA 1 cut(s) 390
PauI GCGCGC 2 cut(s) 705, 939
PcsI WCGNNNNNNNCGW 1 cut(s) 354
PctI GAATGC 1 cut(s) 258
PfeI GAWTC 5 cut(s) 385, 808, 847, 955, 1001
PinAI ACCGGT 2 cut(s) 573, 612
PleI GAGTC 3 cut(s) 457, 916, 1160
PluTI GGCGCC 2 cut(s) 135, 875
PpsI GAGTC 3 cut(s) 457, 916, 1160
PpuMI RGGWCCY 1 cut(s) 855
PshAI GACNNNNGTC 1 cut(s) 167
Psp5II RGGWCCY 1 cut(s) 855
Psp6I CCWGG 3 cut(s) 224, 816, 831
PspFI CCCAGC 1 cut(s) 35
PspGI CCWGG 3 cut(s) 224, 816, 831
PspN4I GGNNCC 6 cut(s) 133, 230, 458, 873, 923, 1101
PspPPI RGGWCCY 1 cut(s) 855
PteI GCGCGC 2 cut(s) 705, 939
PvuII CAGCTG 1 cut(s) 35
RruI TCGCGA 1 cut(s) 390
SacII CCGCGG 1 cut(s) 826
SalI GTCGAC 1 cut(s) 323
Sau3AI GATC 3 cut(s) 632, 963, 1161
SchI GAGTC 3 cut(s) 457, 917, 1160
ScrFI CCNGG 7 cut(s) 226, 455, 599, 818, 833, 979, 980
SduI GDGCHC 1 cut(s) 441
SfcI CTRYAG 1 cut(s) 680
SfoI GGCGCC 2 cut(s) 133, 873
Sfr303I CCGCGG 1 cut(s) 826
SgrBI CCGCGG 1 cut(s) 826
SinI GGWCC 7 cut(s) 457, 576, 820, 835, 855, 922, 1099
SmaI CCCGGG 1 cut(s) 980
Sse9I AATT 5 cut(s) 14, 47, 766, 992, 1137
SspDI GGCGCC 2 cut(s) 131, 871
SspMI CTAG 1 cut(s) 527
StyD4I CCNGG 7 cut(s) 224, 453, 597, 816, 831, 977, 978
StyI CCWWGG 1 cut(s) 1132
TaaI ACNGT 1 cut(s) 780
TaiI ACGT 3 cut(s) 171, 309, 375
TasI AATT 5 cut(s) 14, 47, 766, 992, 1137
TauI GCSGC 7 cut(s) 84, 671, 806, 828, 872, 877, 919
TfiI GAWTC 5 cut(s) 385, 808, 847, 955, 1001
TscAI CASTG 1 cut(s) 419
TseI GCWGC 6 cut(s) 32, 354, 676, 877, 886, 1069
TspDTI ATGAA 2 cut(s) 735, 947
TspGWI ACGGA 4 cut(s) 26, 52, 801, 1005
TspMI CCCGGG 1 cut(s) 978
TspRI CASTG 1 cut(s) 419
VpaK11BI GGWCC 7 cut(s) 457, 576, 820, 835, 855, 922, 1099
XapI RAATTY 1 cut(s) 14
XcmI CCANNNNNNNNNTGG 1 cut(s) 724
XmaI CCCGGG 1 cut(s) 978
XmiI GTMKAC 1 cut(s) 324
XspI CTAG 1 cut(s) 527
ZraI GACGTC 1 cut(s) 373
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.