Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0019972.1

Orthogroup ID

OG0011989

Physical Location & Seq

Genomic Coordinates Reverse (-)

25348 .. 28988

Gene Structure 3641 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0019972.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1048 bp

ccagattgccattcttggagctggtacttttgtgaagacccaatacattccaaggctggctgagatctctaaccttgtcaaccttaaagccatttggagccgttctgaggaatctgctagaggtgcagttgagattgctgggaaacattttccaggagtagaatgcaaatggggtgatcagggtcttgaggaaattattgcagatagttcaattcttggtgttgctgtggttttagctggccaagctcaggttgatttctcactgaagcttctcaaagcagggaagaatgtccttcaagctacaagtgaattggaaactgcagtgtcaagttataaatctattgttgctaatactcccaataaaccaatctgggcggtagcagaaaattatcgatttgaacctgcttttgttgagggcaagaaactaatgactgaaattggagatgtgatgagcatccaagttattgttgaaggatcaatgaacagttcaaacccttacttctcaagctcttggaggcgagactttaatggtggtttcattctggacatgggagtacatttcgttgcaggactgaggatgcttgctggatgtgagatagtctcagtgtcagctacaacgtctcatgtcgacaagactttacctcccccagataacatatcctctctctttcaactggagaatggctgttctgggatttttgtgatggtggtctcctcaaggtctcccaagatagtttggcgatttgttggcttgaagggaacactggaagttgagcgtggaaaccaagatggacgacatggctatgtggtcacattttatagtgctgatggacaaaggaaaagctccttctaccaatttagaggagtgactgaagaattcatcgcatttattgatgacataaagcaagccactttaaagaagggagctggctatgaagctgagcctcgcatgtcatttctggaaggtgctagagatgttgctgttctagaggcaatgctcgaatctggaggaaagcaaggggcaccagtccatgtgaagaaattttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0006139 GO:0006725 GO:0006732 GO:0006733 GO:0006739 GO:0006740 GO:0006753 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009117 GO:0009987 GO:0016491 GO:0019362 GO:0019637 GO:0034641 GO:0044237 GO:0044238 GO:0044281 GO:0046483 GO:0046496 GO:0051186 GO:0055086 GO:0055114 GO:0071704 GO:0072524 GO:1901360 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GFO_IDH_MocA GFO_IDH_MocA_C

Protein Analysis

348

Amino Acids

37.86

Weight (kDa)

6.29

Isoelectric Point (pI)

33.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011989)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G20790
fragaria_vesca	FvH4_3g43551 FvH4_3g43551
malus_domestica	MD11G1022800.v1.1
prunus_persica	Prupe.6G018500_v2.0.a1
pyrus_communis	pycom11g01860
rosa_chinensis	RchiOBHm_Chr5g0078111
rosa_laevigata	RLG00000031428 RLG00000036752
rosa_multiflora	Rmu_sc0019972.1_g000004
rosa_roxburghii	Rroxscaffold_1G00000370 Rroxscaffold_1G00004110
rosa_rugosa	Rorug05G0458500 Rorug05G0458600
rosa_samantha	Rh5AG052300 Rh5AG513200 Rh5CG559000 Rh5DG119600
rosa_wichuraiana	Rw5G047600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	334
Acc36I	ACCTGC	1 cut(s)	410
AccB1I	GGYRCC	1 cut(s)	1022
AccI	GTMKAC	1 cut(s)	628
AciI	CCGC	1 cut(s)	375
AclWI	GGATC	1 cut(s)	482
AcoI	YGGCCR	1 cut(s)	239
AcsI	RAATTY	2 cut(s)	876, 1041
AcuI	CTGAAG	2 cut(s)	285, 892
AfaI	GTAC	2 cut(s)	26, 556
AfiI	CCNNNNNNNGG	2 cut(s)	107, 248
AgsI	TTSAA	7 cut(s)	211, 297, 399, 471, 490, 672, 755
AjnI	CCWGG	1 cut(s)	152
Alw26I	GTCTC	5 cut(s)	514, 605, 625, 716, 727
AlwI	GGATC	1 cut(s)	482
AoxI	GGCC	1 cut(s)	239
ApoI	RAATTY	2 cut(s)	876, 1041
AsuHPI	GGTGA	1 cut(s)	186
BaeGI	GKGCMC	1 cut(s)	1025
BaeI	ACNNNNGTAYC	2 cut(s)	16, 49
BalI	TGGCCA	1 cut(s)	241
BanI	GGYRCC	1 cut(s)	1022
BarI	GAAGNNNNNNTAC	2 cut(s)	27, 59
BbsI	GAAGAC	1 cut(s)	42
BccI	CCATC	3 cut(s)	698, 783, 822
BceAI	ACGGC	1 cut(s)	85
BciT130I	CCWGG	1 cut(s)	154
BclI	TGATCA	1 cut(s)	176
BcoDI	GTCTC	5 cut(s)	514, 605, 625, 716, 727
BfaI	CTAG	3 cut(s)	118, 970, 987
BfmI	CTRYAG	1 cut(s)	319
BfuAI	ACCTGC	1 cut(s)	410
BglII	AGATCT	1 cut(s)	64
BlpI	GCTNAGC	1 cut(s)	940
Bme1390I	CCNGG	1 cut(s)	154
BmiI	GGNNCC	2 cut(s)	99, 1024
BmrFI	CCNGG	1 cut(s)	154
BmsI	GCATC	2 cut(s)	463, 568
BpiI	GAAGAC	1 cut(s)	42
BplI	GAGNNNNNCTC	2 cut(s)	585, 617
BpmI	CTGGAG	2 cut(s)	696, 1027
Bpu10I	CCTNAGC	1 cut(s)	247
Bpu1102I	GCTNAGC	1 cut(s)	940
BpuEI	CTTGAG	3 cut(s)	207, 488, 701
Bsa29I	ATCGAT	1 cut(s)	392
BsaBI	GATNNNNATC	1 cut(s)	453
BsaI	GGTCTC	2 cut(s)	716, 727
BsaJI	CCNNGG	1 cut(s)	51
BsaXI	ACNNNNNCTCC	2 cut(s)	626, 656
Bsc4I	CCNNNNNNNGG	2 cut(s)	107, 248
Bse1I	ACTGG	3 cut(s)	679, 769, 1026
Bse3DI	GCAATG	1 cut(s)	1000
Bse8I	GATNNNNATC	1 cut(s)	453
BseBI	CCWGG	1 cut(s)	154
BseCI	ATCGAT	1 cut(s)	392
BseDI	CCNNGG	1 cut(s)	51
BseGI	GGATG	3 cut(s)	454, 583, 594
BseJI	GATNNNNATC	1 cut(s)	453
BseLI	CCNNNNNNNGG	2 cut(s)	107, 248
BseMI	GCAATG	1 cut(s)	1000
BseMII	CTCAG	6 cut(s)	52, 97, 261, 564, 616, 931
BseNI	ACTGG	3 cut(s)	679, 769, 1026
BseRI	GAGGAG	2 cut(s)	704, 877
BseSI	GKGCMC	1 cut(s)	1025
BseYI	CCCAGC	1 cut(s)	138
BsgI	GTGCAG	1 cut(s)	145
BshFI	GGCC	1 cut(s)	241
BshNI	GGYRCC	1 cut(s)	1022
BshVI	ATCGAT	1 cut(s)	392
BslI	CCNNNNNNNGG	2 cut(s)	107, 248
BsmAI	GTCTC	5 cut(s)	514, 605, 625, 716, 727
BsmBI	CGTCTC	1 cut(s)	625
BsmI	GAATGC	1 cut(s)	168
BsnI	GGCC	1 cut(s)	241
Bso31I	GGTCTC	2 cut(s)	716, 727
Bsp1286I	GDGCHC	1 cut(s)	1025
Bsp143I	GATC	3 cut(s)	64, 176, 474
Bsp1720I	GCTNAGC	1 cut(s)	940
BspACI	CCGC	1 cut(s)	375
BspANI	GGCC	1 cut(s)	241
BspCNI	CTCAG	6 cut(s)	53, 98, 260, 565, 615, 932
BspDI	ATCGAT	1 cut(s)	392
BspLI	GGNNCC	2 cut(s)	99, 1024
BspMAI	CTGCAG	1 cut(s)	323
BspMI	ACCTGC	1 cut(s)	410
BspPI	GGATC	1 cut(s)	482
BspT107I	GGYRCC	1 cut(s)	1022
BspTNI	GGTCTC	2 cut(s)	716, 727
BsrDI	GCAATG	1 cut(s)	1000
BsrI	ACTGG	3 cut(s)	679, 769, 1026
BssECI	CCNNGG	1 cut(s)	51
BssMI	GATC	3 cut(s)	64, 176, 474
BssT1I	CCWWGG	1 cut(s)	51
Bst2UI	CCWGG	1 cut(s)	154
Bst4CI	ACNGT	1 cut(s)	486
BstC8I	GCNNGC	5 cut(s)	58, 239, 583, 907, 929
BstDEI	CTNAG	6 cut(s)	61, 106, 247, 573, 602, 940
BstF5I	GGATG	3 cut(s)	454, 583, 594
BstKTI	GATC	3 cut(s)	67, 179, 477
BstMAI	GTCTC	5 cut(s)	514, 605, 625, 716, 727
BstMBI	GATC	3 cut(s)	64, 176, 474
BstMWI	GCNNNNNNNGC	2 cut(s)	123, 243
BstNI	CCWGG	1 cut(s)	154
BstNSI	RCATGY	1 cut(s)	953
BstSCI	CCNGG	1 cut(s)	152
BstSFI	CTRYAG	1 cut(s)	319
BstSLI	GKGCMC	1 cut(s)	1025
BstV2I	GAAGAC	1 cut(s)	42
BstX2I	RGATCY	1 cut(s)	64
BstYI	RGATCY	1 cut(s)	64
Bsu15I	ATCGAT	1 cut(s)	392
BsuRI	GGCC	1 cut(s)	241
BsuTUI	ATCGAT	1 cut(s)	392
BtgZI	GCGATG	1 cut(s)	866
BtsCI	GGATG	3 cut(s)	454, 583, 594
BtsI	GCAGTG	1 cut(s)	328
BtsIMutI	CAGTG	4 cut(s)	261, 328, 610, 762
BveI	ACCTGC	1 cut(s)	410
Cac8I	GCNNGC	5 cut(s)	58, 239, 583, 907, 929
ClaI	ATCGAT	1 cut(s)	392
Csp6I	GTAC	2 cut(s)	25, 555
CviAII	CATG	5 cut(s)	548, 624, 798, 950, 1032
CviQI	GTAC	2 cut(s)	25, 555
DdeI	CTNAG	6 cut(s)	61, 106, 247, 573, 602, 940
DpnI	GATC	3 cut(s)	66, 178, 476
DpnII	GATC	3 cut(s)	64, 176, 474
DraI	TTTAAA	1 cut(s)	916
EaeI	YGGCCR	1 cut(s)	239
Eco130I	CCWWGG	1 cut(s)	51
Eco31I	GGTCTC	2 cut(s)	716, 727
Eco57I	CTGAAG	2 cut(s)	285, 892
EcoRI	GAATTC	1 cut(s)	876
EcoRII	CCWGG	1 cut(s)	152
EcoT14I	CCWWGG	1 cut(s)	51
ErhI	CCWWGG	1 cut(s)	51
Esp3I	CGTCTC	1 cut(s)	625
FaeI	CATG	5 cut(s)	551, 627, 801, 953, 1035
FatI	CATG	5 cut(s)	547, 623, 797, 949, 1031
FbaI	TGATCA	1 cut(s)	176
FblI	GTMKAC	1 cut(s)	628
FokI	GGATG	3 cut(s)	441, 590, 601
FspBI	CTAG	3 cut(s)	118, 970, 987
GsaI	CCCAGC	1 cut(s)	142
GsuI	CTGGAG	2 cut(s)	696, 1027
HaeIII	GGCC	1 cut(s)	241
Hin1II	CATG	5 cut(s)	551, 627, 801, 953, 1035
HincII	GTYRAC	2 cut(s)	80, 629
HindII	GTYRAC	2 cut(s)	80, 629
HindIII	AAGCTT	1 cut(s)	267
HinfI	GANTC	2 cut(s)	111, 1002
HphI	GGTGA	1 cut(s)	186
Hpy166II	GTNNAC	2 cut(s)	80, 629
Hpy188I	TCNGA	1 cut(s)	107
Hpy188III	TCNNGA	5 cut(s)	186, 543, 960, 987, 1006
Hpy8I	GTNNAC	2 cut(s)	80, 629
HpyAV	CCTTC	6 cut(s)	303, 465, 749, 857, 914, 957
HpyCH4III	ACNGT	1 cut(s)	486
HpyCH4IV	ACGT	1 cut(s)	618
HpyCH4V	TGCA	5 cut(s)	126, 166, 201, 321, 567
HpyF10VI	GCNNNNNNNGC	2 cut(s)	123, 243
HpyF3I	CTNAG	6 cut(s)	61, 106, 247, 573, 602, 940
HpySE526I	ACGT	1 cut(s)	618
Hsp92II	CATG	5 cut(s)	551, 627, 801, 953, 1035
Ksp22I	TGATCA	1 cut(s)	176
Kzo9I	GATC	3 cut(s)	64, 176, 474
LmnI	GCTCC	4 cut(s)	18, 97, 849, 924
LweI	GCATC	2 cut(s)	463, 568
MaeI	CTAG	3 cut(s)	118, 970, 987
MaeII	ACGT	1 cut(s)	618
MaeIII	GTNAC	2 cut(s)	809, 866
MalI	GATC	3 cut(s)	66, 178, 476
MboI	GATC	3 cut(s)	64, 176, 474
MboII	GAAGA	3 cut(s)	47, 296, 885
MflI	RGATCY	1 cut(s)	64
MhlI	GDGCHC	1 cut(s)	1025
MlsI	TGGCCA	1 cut(s)	241
MluCI	AATT	8 cut(s)	193, 211, 309, 386, 436, 855, 876, 1041
MluNI	TGGCCA	1 cut(s)	241
Mox20I	TGGCCA	1 cut(s)	241
MscI	TGGCCA	1 cut(s)	241
MseI	TTAA	3 cut(s)	85, 526, 915
MslI	CAYNNNNRTG	1 cut(s)	802
Msp20I	TGGCCA	1 cut(s)	241
MspR9I	CCNGG	1 cut(s)	154
Mva1269I	GAATGC	1 cut(s)	168
MvaI	CCWGG	1 cut(s)	154
MwoI	GCNNNNNNNGC	2 cut(s)	123, 243
NdeII	GATC	3 cut(s)	64, 176, 474
NlaIII	CATG	5 cut(s)	551, 627, 801, 953, 1035
NlaIV	GGNNCC	2 cut(s)	99, 1024
NmuCI	GTSAC	2 cut(s)	809, 866
NspI	RCATGY	1 cut(s)	953
PctI	GAATGC	1 cut(s)	168
PfeI	GAWTC	2 cut(s)	111, 1002
PfoI	TCCNGGA	1 cut(s)	152
PsiI	TTATAA	1 cut(s)	334
Psp6I	CCWGG	1 cut(s)	152
PspFI	CCCAGC	1 cut(s)	138
PspGI	CCWGG	1 cut(s)	152
PspN4I	GGNNCC	2 cut(s)	99, 1024
PstI	CTGCAG	1 cut(s)	323
PsuI	RGATCY	1 cut(s)	64
RsaI	GTAC	2 cut(s)	26, 556
RsaNI	GTAC	2 cut(s)	25, 555
RseI	CAYNNNNRTG	1 cut(s)	802
SalI	GTCGAC	1 cut(s)	627
SaqAI	TTAA	3 cut(s)	85, 526, 915
Sau3AI	GATC	3 cut(s)	64, 176, 474
ScrFI	CCNGG	1 cut(s)	154
SduI	GDGCHC	1 cut(s)	1025
SfaNI	GCATC	2 cut(s)	463, 568
SfcI	CTRYAG	1 cut(s)	319
SmiMI	CAYNNNNRTG	1 cut(s)	802
SmlI	CTYRAG	3 cut(s)	186, 503, 716
SmoI	CTYRAG	3 cut(s)	186, 503, 716
Sse9I	AATT	8 cut(s)	193, 211, 309, 386, 436, 855, 876, 1041
SsiI	CCGC	1 cut(s)	375
SspMI	CTAG	3 cut(s)	118, 970, 987
StyD4I	CCNGG	1 cut(s)	152
StyI	CCWWGG	1 cut(s)	51
TaaI	ACNGT	1 cut(s)	486
TaiI	ACGT	1 cut(s)	621
TaqI	TCGA	3 cut(s)	392, 628, 1000
TasI	AATT	8 cut(s)	193, 211, 309, 386, 436, 855, 876, 1041
TatI	WGTACW	1 cut(s)	554
TfiI	GAWTC	2 cut(s)	111, 1002
Tru1I	TTAA	3 cut(s)	85, 526, 915
Tru9I	TTAA	3 cut(s)	85, 526, 915
TscAI	CASTG	4 cut(s)	268, 328, 610, 769
TseFI	GTSAC	2 cut(s)	809, 866
Tsp45I	GTSAC	2 cut(s)	809, 866
TspDTI	ATGAA	4 cut(s)	495, 527, 869, 949
TspRI	CASTG	4 cut(s)	268, 328, 610, 769
XapI	RAATTY	2 cut(s)	876, 1041
XbaI	TCTAGA	1 cut(s)	986
XceI	RCATGY	1 cut(s)	953
XmiI	GTMKAC	1 cut(s)	628
XspI	CTAG	3 cut(s)	118, 970, 987

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.