Rmu_sc0020854.1_g000001

Protein CURVATURE THYLAKOID 1A

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020854.1
OG0005869
Physical Location & Seq
Reverse (-)
867 .. 2707
1841 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020854.1_g000001.1.cds

Sequence Viewer

Length: 341 bp
agtcccggaggcgttcccttcaggtcagagcatcatctgaagagacatccacttccgttgacactggagaactaatatcagacttgaaggagaagtgggatgcagttgaaaacaagtcaacagtaattgtgtatggaggtggggcaatcgttgctttgtggctgtcttcaatacttgttggtgccgtcaattcagtgccactgcttccaaagatcctggagttggtagggctaggatatactggatggttcgtctaccgttacctgctcttcaagtcgagcagaaaagaactagctacagacattgatgcattgaagaagaagatcactggaaccgaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CAAD

Protein Analysis

112

Amino Acids

12.31

Weight (kDa)

8.92

Isoelectric Point (pI)

35.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 272
AccB1I GGYRCC 1 cut(s) 181
AccI GTMKAC 1 cut(s) 254
AclWI GGATC 1 cut(s) 207
AcuI CTGAAG 2 cut(s) 4, 59
AfiI CCNNNNNNNGG 1 cut(s) 222
AgsI TTSAA 5 cut(s) 87, 109, 170, 273, 315
AjnI CCWGG 1 cut(s) 215
AluBI AGCT 1 cut(s) 295
AluI AGCT 1 cut(s) 295
Alw26I GTCTC 1 cut(s) 37
AlwI GGATC 1 cut(s) 207
AsuC2I CCSGG 1 cut(s) 6
BanI GGYRCC 1 cut(s) 181
BbsI GAAGAC 1 cut(s) 158
BccI CCATC 1 cut(s) 239
BceAI ACGGC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 217
BcnI CCSGG 1 cut(s) 6
BcoDI GTCTC 1 cut(s) 37
BfaI CTAG 2 cut(s) 232, 292
BfmI CTRYAG 1 cut(s) 296
BfuAI ACCTGC 1 cut(s) 272
Bme1390I CCNGG 2 cut(s) 6, 217
BmiI GGNNCC 2 cut(s) 183, 333
BmrFI CCNGG 2 cut(s) 6, 217
BmsI GCATC 3 cut(s) 40, 90, 297
BpiI GAAGAC 1 cut(s) 158
BpmI CTGGAG 2 cut(s) 86, 238
BpuMI CCSGG 1 cut(s) 6
Bsc4I CCNNNNNNNGG 1 cut(s) 222
Bse1I ACTGG 3 cut(s) 69, 246, 333
BseBI CCWGG 1 cut(s) 217
BseGI GGATG 3 cut(s) 46, 105, 250
BseLI CCNNNNNNNGG 1 cut(s) 222
BseNI ACTGG 3 cut(s) 69, 246, 333
BshNI GGYRCC 1 cut(s) 181
BsiSI CCGG 1 cut(s) 6
BslI CCNNNNNNNGG 1 cut(s) 222
BsmAI GTCTC 1 cut(s) 37
Bsp143I GATC 2 cut(s) 212, 323
BspLI GGNNCC 2 cut(s) 183, 333
BspMI ACCTGC 1 cut(s) 272
BspPI GGATC 1 cut(s) 207
BspQI GCTCTTC 1 cut(s) 274
BspT107I GGYRCC 1 cut(s) 181
BsrI ACTGG 3 cut(s) 69, 246, 333
BssMI GATC 2 cut(s) 212, 323
Bst2UI CCWGG 1 cut(s) 217
Bst4CI ACNGT 2 cut(s) 123, 259
Bst6I CTCTTC 2 cut(s) 35, 274
BstAPI GCANNNNNTGC 1 cut(s) 151
BstF5I GGATG 3 cut(s) 46, 105, 250
BstKTI GATC 2 cut(s) 215, 326
BstMAI GTCTC 1 cut(s) 37
BstMBI GATC 2 cut(s) 212, 323
BstMWI GCNNNNNNNGC 1 cut(s) 151
BstNI CCWGG 1 cut(s) 217
BstSCI CCNGG 2 cut(s) 4, 215
BstSFI CTRYAG 1 cut(s) 296
BstV2I GAAGAC 1 cut(s) 158
BstX2I RGATCY 1 cut(s) 212
BstYI RGATCY 1 cut(s) 212
BtsCI GGATG 3 cut(s) 46, 105, 250
BtsI GCAGTG 1 cut(s) 199
BtsIMutI CAGTG 4 cut(s) 62, 199, 200, 326
BveI ACCTGC 1 cut(s) 272
CspCI CAANNNNNGTGG 2 cut(s) 39, 74
CviJI RGCY 3 cut(s) 162, 231, 295
CviKI_1 RGCY 3 cut(s) 162, 231, 295
DpnI GATC 2 cut(s) 214, 325
DpnII GATC 2 cut(s) 212, 323
Eam1104I CTCTTC 2 cut(s) 35, 274
EarI CTCTTC 2 cut(s) 35, 274
Eco57I CTGAAG 2 cut(s) 4, 59
EcoRII CCWGG 1 cut(s) 215
EcoT22I ATGCAT 1 cut(s) 312
FaiI YATR 2 cut(s) 134, 239
FblI GTMKAC 1 cut(s) 254
FokI GGATG 3 cut(s) 33, 112, 257
FspBI CTAG 2 cut(s) 232, 292
GsuI CTGGAG 2 cut(s) 86, 238
HapII CCGG 1 cut(s) 6
HincII GTYRAC 2 cut(s) 60, 119
HindII GTYRAC 2 cut(s) 60, 119
HpaII CCGG 1 cut(s) 6
Hpy166II GTNNAC 3 cut(s) 60, 119, 255
Hpy188I TCNGA 3 cut(s) 28, 39, 81
Hpy8I GTNNAC 3 cut(s) 60, 119, 255
HpyAV CCTTC 2 cut(s) 28, 81
HpyCH4III ACNGT 2 cut(s) 123, 259
HpyCH4V TGCA 2 cut(s) 103, 310
HpyF10VI GCNNNNNNNGC 1 cut(s) 151
Kzo9I GATC 2 cut(s) 212, 323
LguI GCTCTTC 1 cut(s) 274
LpnPI CCDG 8 cut(s) 7, 19, 50, 202, 227, 229, 277, 314
LweI GCATC 3 cut(s) 40, 90, 297
MaeI CTAG 2 cut(s) 232, 292
MaeIII GTNAC 1 cut(s) 259
MalI GATC 2 cut(s) 214, 325
MboI GATC 2 cut(s) 212, 323
MboII GAAGA 6 cut(s) 52, 158, 261, 327, 330, 333
MflI RGATCY 1 cut(s) 212
MluCI AATT 2 cut(s) 125, 189
MnlI CCTC 1 cut(s) 130
Mph1103I ATGCAT 1 cut(s) 312
MspI CCGG 1 cut(s) 6
MspR9I CCNGG 2 cut(s) 6, 217
MvaI CCWGG 1 cut(s) 217
MwoI GCNNNNNNNGC 1 cut(s) 151
NciI CCSGG 1 cut(s) 6
NdeII GATC 2 cut(s) 212, 323
NlaIV GGNNCC 2 cut(s) 183, 333
NsiI ATGCAT 1 cut(s) 312
PciSI GCTCTTC 1 cut(s) 274
PfoI TCCNGGA 2 cut(s) 4, 215
Psp6I CCWGG 1 cut(s) 215
PspGI CCWGG 1 cut(s) 215
PspN4I GGNNCC 2 cut(s) 183, 333
PsuI RGATCY 1 cut(s) 212
SapI GCTCTTC 1 cut(s) 274
Sau3AI GATC 2 cut(s) 212, 323
ScrFI CCNGG 2 cut(s) 6, 217
SetI ASST 4 cut(s) 26, 141, 266, 297
SfaNI GCATC 3 cut(s) 40, 90, 297
SfcI CTRYAG 1 cut(s) 296
Sse9I AATT 2 cut(s) 125, 189
SspMI CTAG 2 cut(s) 232, 292
StyD4I CCNGG 2 cut(s) 4, 215
TaaI ACNGT 2 cut(s) 123, 259
TaqI TCGA 1 cut(s) 277
TasI AATT 2 cut(s) 125, 189
TscAI CASTG 4 cut(s) 69, 200, 206, 333
TspGWI ACGGA 1 cut(s) 45
TspRI CASTG 4 cut(s) 69, 200, 206, 333
XmiI GTMKAC 1 cut(s) 254
XspI CTAG 2 cut(s) 232, 292
Zsp2I ATGCAT 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.