Rmu_sc0042879.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042879.1
OG0008642
Physical Location & Seq
Forward (+)
1 .. 572
572 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042879.1_g000001.1.cds

Sequence Viewer

Length: 387 bp
aagcagaggattcatgccgggctttggatgaaggagattgagaagcagcaagaggctaaattagctgattccggttccattcgtggcggtgacgacgatatcgaacgcttgcttgatagctgctccgatatcttcgattctaccaacaatgatttggaaaatgccaaagtgccgagcgctgatgatttcaagaacaagccggatggttgggaaacgacagccaaggctgaagagggaagtgtgtgggagatgacacagagggaagaggatatccttctccaagagtttgagcgtcgaattgcgtataataagtttcaggtgtgtacattcagcaactctcagacttgcttcttttcgagtatcagcttaaataaatggagcaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

128

Amino Acids

14.72

Weight (kDa)

4.69

Isoelectric Point (pI)

62.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 87
AcuI CTGAAG 1 cut(s) 249
AfaI GTAC 1 cut(s) 325
AfeI AGCGCT 1 cut(s) 178
AfiI CCNNNNNNNGG 1 cut(s) 24
AgsI TTSAA 1 cut(s) 190
AluBI AGCT 3 cut(s) 65, 120, 366
AluI AGCT 3 cut(s) 65, 120, 366
Aor51HI AGCGCT 1 cut(s) 178
ApeKI GCWGC 2 cut(s) 46, 120
AspLEI GCGC 1 cut(s) 179
AsuC2I CCSGG 1 cut(s) 19
AsuHPI GGTGA 1 cut(s) 101
BbvI GCAGC 2 cut(s) 58, 107
BccI CCATC 1 cut(s) 197
BcnI CCSGG 1 cut(s) 19
BfoI RGCGCY 1 cut(s) 180
BisI GCNGC 2 cut(s) 47, 121
BlsI GCNGC 2 cut(s) 48, 122
Bme1390I CCNGG 1 cut(s) 19
BmiI GGNNCC 1 cut(s) 76
BmrFI CCNGG 1 cut(s) 19
BpuMI CCSGG 1 cut(s) 19
BsaJI CCNNGG 1 cut(s) 222
BsaWI WCCGGW 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 222
BseGI GGATG 2 cut(s) 33, 208
BseLI CCNNNNNNNGG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 353
BseXI GCAGC 2 cut(s) 58, 107
BsiSI CCGG 3 cut(s) 18, 72, 200
BslI CCNNNNNNNGG 1 cut(s) 24
Bsp1407I TGTACA 1 cut(s) 323
BspACI CCGC 1 cut(s) 87
BspCNI CTCAG 1 cut(s) 352
BspLI GGNNCC 1 cut(s) 76
BsrGI TGTACA 1 cut(s) 323
BssECI CCNNGG 1 cut(s) 222
BssT1I CCWWGG 1 cut(s) 222
Bst6I CTCTTC 2 cut(s) 225, 258
BstAUI TGTACA 1 cut(s) 323
BstC8I GCNNGC 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 339
BstF5I GGATG 2 cut(s) 33, 208
BstH2I RGCGCY 1 cut(s) 180
BstHHI GCGC 1 cut(s) 179
BstMWI GCNNNNNNNGC 1 cut(s) 62
BstSCI CCNGG 1 cut(s) 17
BstV1I GCAGC 2 cut(s) 58, 107
BtsCI GGATG 2 cut(s) 33, 208
Cac8I GCNNGC 1 cut(s) 110
CfoI GCGC 1 cut(s) 179
CseI GACGC 1 cut(s) 281
Csp6I GTAC 1 cut(s) 324
CviAII CATG 1 cut(s) 14
CviJI RGCY 8 cut(s) 22, 56, 65, 120, 199, 221, 227, 366
CviKI_1 RGCY 8 cut(s) 22, 56, 65, 120, 199, 221, 227, 366
CviQI GTAC 1 cut(s) 324
DdeI CTNAG 1 cut(s) 339
Eam1104I CTCTTC 2 cut(s) 225, 258
EarI CTCTTC 2 cut(s) 225, 258
Eco130I CCWWGG 1 cut(s) 222
Eco32I GATATC 3 cut(s) 100, 130, 271
Eco47III AGCGCT 1 cut(s) 178
Eco57I CTGAAG 1 cut(s) 249
EcoRV GATATC 3 cut(s) 100, 130, 271
EcoT14I CCWWGG 1 cut(s) 222
ErhI CCWWGG 1 cut(s) 222
FaeI CATG 1 cut(s) 17
FaiI YATR 2 cut(s) 15, 306
FatI CATG 1 cut(s) 13
Fnu4HI GCNGC 2 cut(s) 47, 121
FokI GGATG 2 cut(s) 40, 215
Fsp4HI GCNGC 2 cut(s) 47, 121
GlaI GCGC 1 cut(s) 178
GluI GCNGC 2 cut(s) 47, 121
HaeII RGCGCY 1 cut(s) 180
HapII CCGG 3 cut(s) 18, 72, 200
HgaI GACGC 1 cut(s) 281
HhaI GCGC 1 cut(s) 179
Hin1II CATG 1 cut(s) 17
Hin6I GCGC 1 cut(s) 177
HinP1I GCGC 1 cut(s) 177
HinfI GANTC 3 cut(s) 10, 68, 137
HpaII CCGG 3 cut(s) 18, 72, 200
HphI GGTGA 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 324
Hpy188I TCNGA 2 cut(s) 127, 342
Hpy188III TCNNGA 1 cut(s) 190
Hpy8I GTNNAC 1 cut(s) 324
Hpy99I CGWCG 2 cut(s) 98, 297
HpyAV CCTTC 2 cut(s) 25, 284
HpyF10VI GCNNNNNNNGC 1 cut(s) 62
HpyF3I CTNAG 1 cut(s) 339
Hsp92II CATG 1 cut(s) 17
HspAI GCGC 1 cut(s) 177
LmnI GCTCC 2 cut(s) 128, 378
LpnPI CCDG 4 cut(s) 31, 85, 213, 302
Lsp1109I GCAGC 2 cut(s) 58, 107
MaeIII GTNAC 1 cut(s) 89
MboII GAAGA 3 cut(s) 124, 242, 275
MluCI AATT 2 cut(s) 59, 297
MnlI CCTC 4 cut(s) 46, 226, 252, 259
MseI TTAA 1 cut(s) 368
MspI CCGG 3 cut(s) 18, 72, 200
MspR9I CCNGG 1 cut(s) 19
MwoI GCNNNNNNNGC 1 cut(s) 62
NciI CCSGG 1 cut(s) 19
NlaIII CATG 1 cut(s) 17
NlaIV GGNNCC 1 cut(s) 76
NmeAIII GCCGAG 1 cut(s) 198
NmuCI GTSAC 1 cut(s) 89
PcsI WCGNNNNNNNCGW 1 cut(s) 99
PfeI GAWTC 3 cut(s) 10, 68, 137
PkrI GCNGC 2 cut(s) 48, 122
PspN4I GGNNCC 1 cut(s) 76
RsaI GTAC 1 cut(s) 325
RsaNI GTAC 1 cut(s) 324
SaqAI TTAA 1 cut(s) 368
SatI GCNGC 2 cut(s) 47, 121
ScrFI CCNGG 1 cut(s) 19
SetI ASST 4 cut(s) 67, 122, 321, 368
Sse9I AATT 2 cut(s) 59, 297
SsiI CCGC 1 cut(s) 87
StyD4I CCNGG 1 cut(s) 17
StyI CCWWGG 1 cut(s) 222
TaqI TCGA 4 cut(s) 102, 135, 295, 356
TasI AATT 2 cut(s) 59, 297
TatI WGTACW 1 cut(s) 323
TfiI GAWTC 3 cut(s) 10, 68, 137
Tru1I TTAA 1 cut(s) 368
Tru9I TTAA 1 cut(s) 368
TseFI GTSAC 1 cut(s) 89
TseI GCWGC 2 cut(s) 46, 120
Tsp45I GTSAC 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 44
XcmI CCANNNNNNNNNTGG 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.