Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000089.1

Orthogroup ID

OG0010546

Physical Location & Seq

Genomic Coordinates Reverse (-)

233853 .. 237947

Gene Structure 4095 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000089.1_g000034.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 759 bp

atgagttggaacccgcatatgggagttcattacccctacaacagctgtccctatagcacggtgggtagctttatggactatgttgaaggcctcacctacgaacatgtgaactttattttttcaggggattcacatgctcaggagagcacttacccatcaatgaatacgaactattacaagtttgggttaactgaacctgggaatacttcatattatgaacttggttttcgtcattcctatgagttcaatgatcctatctcaagaagtggtgaagaaacaaggcctttgcagtactcttcaactattcctaatgaacagaatgtggcaagggatccaccatgtgaaggaagtgcaaacacttccacatgtgacaaccccagagaatcccctcgaagatatcagaactcccaggattatcaggttattttggaagacaacattgaccctgatagcatgacttacgaggaattactagaattaggtgaggcagttggaactgaaagccgaggtcttacccaagatatgctttctttgcttccaatctcaaagtacaagtgcagctttttctcaagaaagaaatcacggagtgagaggtgtgtgatttgccagatggaatataaacgaggggatcggcagatcactctgccgtgcaaacacctctatcatgctggatgtggaaccagatggcttagcatgaacaaggcttgcccagtatgctacaccgaggtatttggtaatggatcgatgagcaagaagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-RING_2

Protein Analysis

252

Amino Acids

28.86

Weight (kDa)

5.53

Isoelectric Point (pI)

52.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010546)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g29040
malus_domestica	MD03G1178200.v1.1 MD11G1198000.v1.1
prunus_persica	Prupe.4G244600_v2.0.a1 Prupe.4G244600_v2.0.a1 Prupe.4G244600_v2.0.a1 Prupe.4G244600_v2.0.a1
pyrus_communis	pycom03g13490 pycom11g17140
rosa_chinensis	RchiOBHm_Chr5g0051621
rosa_laevigata	RLG00000034872
rosa_multiflora	Rmu_ssc0000089.1_g000034
rosa_roxburghii	Rroxscaffold_1G00027100
rosa_rugosa	Rorug05G0278700 Rorug05G0278800 Rorug05G0278900
rosa_samantha	Rh5AG350000 Rh5BG361800 Rh5CG386700 Rh5DG376700
rosa_wichuraiana	Rw5G033120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	14
AclWI	GGATC	5 cut(s)	245, 326, 339, 636, 748
AdeI	CACNNNGTG	2 cut(s)	341, 587
AfaI	GTAC	2 cut(s)	293, 551
AfiI	CCNNNNNNNGG	3 cut(s)	19, 20, 344
AflIII	ACRYGT	2 cut(s)	103, 365
AgsI	TTSAA	3 cut(s)	86, 247, 300
AjnI	CCWGG	2 cut(s)	196, 408
AluBI	AGCT	3 cut(s)	45, 69, 561
AluI	AGCT	3 cut(s)	45, 69, 561
Alw21I	GWGCWC	1 cut(s)	149
AlwI	GGATC	5 cut(s)	245, 326, 339, 636, 748
AoxI	GGCC	2 cut(s)	88, 281
ApeKI	GCWGC	1 cut(s)	558
AsuHPI	GGTGA	3 cut(s)	85, 281, 494
BamHI	GGATCC	1 cut(s)	331
BbsI	GAAGAC	1 cut(s)	438
Bbv12I	GWGCWC	1 cut(s)	149
BbvI	GCAGC	1 cut(s)	570
BccI	CCATC	3 cut(s)	163, 604, 678
BceAI	ACGGC	1 cut(s)	631
BciT130I	CCWGG	2 cut(s)	198, 410
BfaI	CTAG	1 cut(s)	473
BfmI	CTRYAG	1 cut(s)	52
BisI	GCNGC	1 cut(s)	559
BlpI	GCTNAGC	1 cut(s)	689
BlsI	GCNGC	1 cut(s)	560
BmcAI	AGTACT	1 cut(s)	293
Bme1390I	CCNGG	2 cut(s)	198, 410
BmiI	GGNNCC	3 cut(s)	11, 333, 679
BmrFI	CCNGG	2 cut(s)	198, 410
BmrI	ACTGGG	1 cut(s)	704
BmuI	ACTGGG	1 cut(s)	704
BpiI	GAAGAC	1 cut(s)	438
Bpu10I	CCTNAGC	1 cut(s)	138
Bpu1102I	GCTNAGC	1 cut(s)	689
BpuEI	CTTGAG	2 cut(s)	244, 553
Bsa29I	ATCGAT	1 cut(s)	743
BsaJI	CCNNGG	4 cut(s)	197, 408, 505, 723
Bsc4I	CCNNNNNNNGG	3 cut(s)	19, 20, 344
Bse1I	ACTGG	1 cut(s)	710
BseBI	CCWGG	2 cut(s)	198, 410
BseCI	ATCGAT	1 cut(s)	743
BseDI	CCNNGG	4 cut(s)	197, 408, 505, 723
BseGI	GGATG	1 cut(s)	677
BseLI	CCNNNNNNNGG	3 cut(s)	19, 20, 344
BseMII	CTCAG	1 cut(s)	152
BseNI	ACTGG	1 cut(s)	710
BseXI	GCAGC	1 cut(s)	570
BsgI	GTGCAG	1 cut(s)	577
BshFI	GGCC	2 cut(s)	90, 283
BshVI	ATCGAT	1 cut(s)	743
BsiHKAI	GWGCWC	1 cut(s)	149
BslFI	GGGAC	1 cut(s)	33
BslI	CCNNNNNNNGG	3 cut(s)	19, 20, 344
BsmFI	GGGAC	1 cut(s)	33
BsnI	GGCC	2 cut(s)	90, 283
Bsp1286I	GDGCHC	1 cut(s)	149
Bsp143I	GATC	5 cut(s)	250, 331, 628, 636, 740
Bsp1720I	GCTNAGC	1 cut(s)	689
BspACI	CCGC	1 cut(s)	14
BspANI	GGCC	2 cut(s)	90, 283
BspCNI	CTCAG	1 cut(s)	151
BspDI	ATCGAT	1 cut(s)	743
BspLI	GGNNCC	3 cut(s)	11, 333, 679
BspPI	GGATC	5 cut(s)	245, 326, 339, 636, 748
BsrI	ACTGG	1 cut(s)	710
BssECI	CCNNGG	4 cut(s)	197, 408, 505, 723
BssMI	GATC	5 cut(s)	250, 331, 628, 636, 740
Bst2UI	CCWGG	2 cut(s)	198, 410
Bst4CI	ACNGT	1 cut(s)	61
Bst6I	CTCTTC	1 cut(s)	301
BstC8I	GCNNGC	1 cut(s)	706
BstDEI	CTNAG	2 cut(s)	138, 689
BstF5I	GGATG	1 cut(s)	677
BstKTI	GATC	5 cut(s)	253, 334, 631, 639, 743
BstMBI	GATC	5 cut(s)	250, 331, 628, 636, 740
BstMWI	GCNNNNNNNGC	2 cut(s)	532, 714
BstNI	CCWGG	2 cut(s)	198, 410
BstNSI	RCATGY	3 cut(s)	107, 137, 369
BstSCI	CCNGG	2 cut(s)	196, 408
BstSFI	CTRYAG	1 cut(s)	52
BstV1I	GCAGC	1 cut(s)	570
BstV2I	GAAGAC	1 cut(s)	438
BstX2I	RGATCY	1 cut(s)	331
BstYI	RGATCY	1 cut(s)	331
Bsu15I	ATCGAT	1 cut(s)	743
BsuRI	GGCC	2 cut(s)	90, 283
BsuTUI	ATCGAT	1 cut(s)	743
BtsCI	GGATG	1 cut(s)	677
Cac8I	GCNNGC	1 cut(s)	706
ClaI	ATCGAT	1 cut(s)	743
Csp6I	GTAC	2 cut(s)	292, 550
CviAII	CATG	7 cut(s)	104, 134, 339, 366, 454, 665, 694
CviJI	RGCY	8 cut(s)	45, 69, 90, 283, 504, 561, 688, 704
CviKI_1	RGCY	8 cut(s)	45, 69, 90, 283, 504, 561, 688, 704
CviQI	GTAC	2 cut(s)	292, 550
DdeI	CTNAG	2 cut(s)	138, 689
DpnI	GATC	5 cut(s)	252, 333, 630, 638, 742
DpnII	GATC	5 cut(s)	250, 331, 628, 636, 740
DraIII	CACNNNGTG	2 cut(s)	341, 587
Eam1104I	CTCTTC	1 cut(s)	301
EarI	CTCTTC	1 cut(s)	301
Eco147I	AGGCCT	2 cut(s)	90, 283
Eco32I	GATATC	1 cut(s)	398
EcoRII	CCWGG	2 cut(s)	196, 408
EcoRV	GATATC	1 cut(s)	398
FaeI	CATG	7 cut(s)	107, 137, 342, 369, 457, 668, 697
FalI	AAGNNNNNCTT	4 cut(s)	510, 542, 545, 577
FaqI	GGGAC	1 cut(s)	33
FatI	CATG	7 cut(s)	103, 133, 338, 365, 453, 664, 693
FauI	CCCGC	1 cut(s)	21
FauNDI	CATATG	1 cut(s)	18
Fnu4HI	GCNGC	1 cut(s)	559
FokI	GGATG	1 cut(s)	684
Fsp4HI	GCNGC	1 cut(s)	559
FspBI	CTAG	1 cut(s)	473
GluI	GCNGC	1 cut(s)	559
HaeIII	GGCC	2 cut(s)	90, 283
Hin1II	CATG	7 cut(s)	107, 137, 342, 369, 457, 668, 697
HincII	GTYRAC	1 cut(s)	189
HindII	GTYRAC	1 cut(s)	189
HinfI	GANTC	2 cut(s)	128, 383
HpaI	GTTAAC	1 cut(s)	189
HphI	GGTGA	3 cut(s)	85, 281, 494
Hpy166II	GTNNAC	2 cut(s)	109, 189
Hpy188I	TCNGA	1 cut(s)	402
Hpy188III	TCNNGA	3 cut(s)	140, 261, 570
Hpy8I	GTNNAC	2 cut(s)	109, 189
HpyAV	CCTTC	2 cut(s)	80, 338
HpyCH4III	ACNGT	1 cut(s)	61
HpyCH4V	TGCA	4 cut(s)	289, 353, 558, 651
HpyF10VI	GCNNNNNNNGC	2 cut(s)	532, 714
HpyF3I	CTNAG	2 cut(s)	138, 689
Hsp92II	CATG	7 cut(s)	107, 137, 342, 369, 457, 668, 697
KspAI	GTTAAC	1 cut(s)	189
Kzo9I	GATC	5 cut(s)	250, 331, 628, 636, 740
Lsp1109I	GCAGC	1 cut(s)	570
MaeI	CTAG	1 cut(s)	473
MaeIII	GTNAC	1 cut(s)	368
MalI	GATC	5 cut(s)	252, 333, 630, 638, 742
MboI	GATC	5 cut(s)	250, 331, 628, 636, 740
MboII	GAAGA	4 cut(s)	284, 288, 405, 443
MflI	RGATCY	1 cut(s)	331
MhlI	GDGCHC	1 cut(s)	149
MluCI	AATT	2 cut(s)	467, 476
MmeI	TCCRAC	1 cut(s)	472
MnlI	CCTC	9 cut(s)	101, 399, 457, 478, 500, 585, 617, 668, 718
MseI	TTAA	1 cut(s)	188
MslI	CAYNNNNRTG	1 cut(s)	237
MspA1I	CMGCKG	1 cut(s)	45
MspR9I	CCNGG	2 cut(s)	198, 410
MvaI	CCWGG	2 cut(s)	198, 410
MwoI	GCNNNNNNNGC	2 cut(s)	532, 714
NdeI	CATATG	1 cut(s)	18
NdeII	GATC	5 cut(s)	250, 331, 628, 636, 740
NlaIII	CATG	7 cut(s)	107, 137, 342, 369, 457, 668, 697
NlaIV	GGNNCC	3 cut(s)	11, 333, 679
NmeAIII	GCCGAG	1 cut(s)	530
NmuCI	GTSAC	1 cut(s)	368
NspI	RCATGY	3 cut(s)	107, 137, 369
PceI	AGGCCT	2 cut(s)	90, 283
PciI	ACATGT	2 cut(s)	103, 365
PfeI	GAWTC	2 cut(s)	128, 383
PkrI	GCNGC	1 cut(s)	560
PscI	ACATGT	2 cut(s)	103, 365
Psp6I	CCWGG	2 cut(s)	196, 408
PspGI	CCWGG	2 cut(s)	196, 408
PspN4I	GGNNCC	3 cut(s)	11, 333, 679
PsuI	RGATCY	1 cut(s)	331
PvuII	CAGCTG	1 cut(s)	45
RsaI	GTAC	2 cut(s)	293, 551
RsaNI	GTAC	2 cut(s)	292, 550
RseI	CAYNNNNRTG	1 cut(s)	237
SaqAI	TTAA	1 cut(s)	188
SatI	GCNGC	1 cut(s)	559
Sau3AI	GATC	5 cut(s)	250, 331, 628, 636, 740
ScaI	AGTACT	1 cut(s)	293
ScrFI	CCNGG	2 cut(s)	198, 410
SduI	GDGCHC	1 cut(s)	149
SfcI	CTRYAG	1 cut(s)	52
SmiMI	CAYNNNNRTG	1 cut(s)	237
SmlI	CTYRAG	2 cut(s)	259, 568
SmoI	CTYRAG	2 cut(s)	259, 568
Sse9I	AATT	2 cut(s)	467, 476
SseBI	AGGCCT	2 cut(s)	90, 283
SsiI	CCGC	1 cut(s)	14
SspMI	CTAG	1 cut(s)	473
StuI	AGGCCT	2 cut(s)	90, 283
StyD4I	CCNGG	2 cut(s)	196, 408
TaaI	ACNGT	1 cut(s)	61
TaqI	TCGA	2 cut(s)	391, 743
TasI	AATT	2 cut(s)	467, 476
TatI	WGTACW	2 cut(s)	291, 549
TfiI	GAWTC	2 cut(s)	128, 383
Tru1I	TTAA	1 cut(s)	188
Tru9I	TTAA	1 cut(s)	188
TseFI	GTSAC	1 cut(s)	368
TseI	GCWGC	1 cut(s)	558
Tsp45I	GTSAC	1 cut(s)	368
TspDTI	ATGAA	6 cut(s)	17, 176, 198, 231, 327, 710
TspGWI	ACGGA	1 cut(s)	598
XceI	RCATGY	3 cut(s)	107, 137, 369
XspI	CTAG	1 cut(s)	473
ZrmI	AGTACT	1 cut(s)	293

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.