Rorug05G0278900

E3 ubiquitin ligase BIG BROTHER-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
31686996 .. 31687394
399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0278900.1

Sequence Viewer

Length: 399 bp
ATGGGCTGTTGCAAGAGCCACCACAATGAGGCAGTTTCAGCATGCAATGGAGGAGTTAAAGAAAACATCTATTGGGGCATAGGATGGTGCATGGATAGACCAGCAAAACATTGGTCTAAGTCACACTTTAAGGAGCAGTTCAAGTGTGACTTACTTCTAAATAACCATAGTGAGTCATTTAACAAGAGTCTGTTGGAAGCTAGGAAAAAATCTATTCTTGGGTGTTTAGAGGATATCAGGACAAGTGCAATGGTGAGGGCATGTAACAGGAGAAACTCAGGGCATAGATGGAAATATAAGGTTGGGCCTAGAGTTGAAAAGCTTAATGAATGGGAATATAACTGTCTTGGAGATGCTGTTTTCATTCTAATCCACAGCCACAAGGTGCCTCCAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

15.2

Weight (kDa)

9.19

Isoelectric Point (pI)

48.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 385
AdeI CACNNNGTG 1 cut(s) 385
AfiI CCNNNNNNNGG 1 cut(s) 28
AgsI TTSAA 2 cut(s) 142, 317
AluBI AGCT 2 cut(s) 200, 322
AluI AGCT 2 cut(s) 200, 322
AoxI GGCC 1 cut(s) 305
ArsI GACNNNNNNTTYG 2 cut(s) 98, 130
AspS9I GGNCC 1 cut(s) 305
AsuHPI GGTGA 1 cut(s) 265
BanI GGYRCC 1 cut(s) 385
BccI CCATC 2 cut(s) 78, 282
BfaI CTAG 2 cut(s) 201, 309
BmgT120I GGNCC 1 cut(s) 305
BmiI GGNNCC 1 cut(s) 387
BmsI GCATC 1 cut(s) 343
BsaXI ACNNNNNCTCC 2 cut(s) 342, 372
Bsc4I CCNNNNNNNGG 1 cut(s) 28
Bse3DI GCAATG 2 cut(s) 52, 255
BseGI GGATG 1 cut(s) 89
BseLI CCNNNNNNNGG 1 cut(s) 28
BseMI GCAATG 2 cut(s) 52, 255
BseMII CTCAG 1 cut(s) 291
BseRI GAGGAG 1 cut(s) 66
BshFI GGCC 1 cut(s) 307
BshNI GGYRCC 1 cut(s) 385
BslI CCNNNNNNNGG 1 cut(s) 28
BsnI GGCC 1 cut(s) 307
BspANI GGCC 1 cut(s) 307
BspCNI CTCAG 1 cut(s) 290
BspLI GGNNCC 1 cut(s) 387
BspT107I GGYRCC 1 cut(s) 385
BsrDI GCAATG 2 cut(s) 52, 255
Bst4CI ACNGT 1 cut(s) 344
BstC8I GCNNGC 1 cut(s) 43
BstDEI CTNAG 2 cut(s) 117, 277
BstF5I GGATG 1 cut(s) 89
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstNSI RCATGY 2 cut(s) 45, 264
BsuRI GGCC 1 cut(s) 307
BtsCI GGATG 1 cut(s) 89
Cac8I GCNNGC 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 305
CviAII CATG 3 cut(s) 42, 91, 261
CviJI RGCY 6 cut(s) 6, 18, 200, 307, 322, 378
CviKI_1 RGCY 6 cut(s) 6, 18, 200, 307, 322, 378
DdeI CTNAG 2 cut(s) 117, 277
DraIII CACNNNGTG 1 cut(s) 385
Eco32I GATATC 1 cut(s) 235
EcoRV GATATC 1 cut(s) 235
FaeI CATG 3 cut(s) 45, 94, 264
FaiI YATR 8 cut(s) 43, 80, 92, 168, 262, 285, 297, 339
FalI AAGNNNNNCTT 4 cut(s) 110, 142, 134, 166
FatI CATG 3 cut(s) 41, 90, 260
FokI GGATG 1 cut(s) 96
FspBI CTAG 2 cut(s) 201, 309
HaeIII GGCC 1 cut(s) 307
Hin1II CATG 3 cut(s) 45, 94, 264
HindIII AAGCTT 1 cut(s) 320
HinfI GANTC 2 cut(s) 173, 187
HphI GGTGA 1 cut(s) 265
Hpy188III TCNNGA 1 cut(s) 238
HpyCH4III ACNGT 1 cut(s) 344
HpyCH4V TGCA 4 cut(s) 12, 45, 90, 248
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 2 cut(s) 117, 277
Hsp92II CATG 3 cut(s) 45, 94, 264
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 4 cut(s) 114, 223, 253, 264
LweI GCATC 1 cut(s) 343
MaeI CTAG 2 cut(s) 201, 309
MaeIII GTNAC 3 cut(s) 120, 146, 263
MlyI GAGTC 2 cut(s) 182, 196
MmeI TCCRAC 1 cut(s) 174
MnlI CCTC 5 cut(s) 22, 44, 223, 249, 399
MseI TTAA 4 cut(s) 57, 129, 180, 324
MslI CAYNNNNRTG 1 cut(s) 24
MwoI GCNNNNNNNGC 1 cut(s) 38
NlaIII CATG 3 cut(s) 45, 94, 264
NlaIV GGNNCC 1 cut(s) 387
NmuCI GTSAC 2 cut(s) 120, 146
NspI RCATGY 2 cut(s) 45, 264
PaeI GCATGC 1 cut(s) 45
PleI GAGTC 2 cut(s) 181, 195
PpsI GAGTC 2 cut(s) 181, 195
PspN4I GGNNCC 1 cut(s) 387
PspPI GGNCC 1 cut(s) 305
RseI CAYNNNNRTG 1 cut(s) 24
SaqAI TTAA 4 cut(s) 57, 129, 180, 324
Sau96I GGNCC 1 cut(s) 305
SchI GAGTC 2 cut(s) 182, 196
SetI ASST 4 cut(s) 202, 303, 324, 387
SfaNI GCATC 1 cut(s) 343
SmiMI CAYNNNNRTG 1 cut(s) 24
SphI GCATGC 1 cut(s) 45
SspMI CTAG 2 cut(s) 201, 309
TaaI ACNGT 1 cut(s) 344
Tru1I TTAA 4 cut(s) 57, 129, 180, 324
Tru9I TTAA 4 cut(s) 57, 129, 180, 324
TseFI GTSAC 2 cut(s) 120, 146
Tsp45I GTSAC 2 cut(s) 120, 146
TspDTI ATGAA 2 cut(s) 342, 352
XceI RCATGY 2 cut(s) 45, 264
XcmI CCANNNNNNNNNTGG 1 cut(s) 108
XspI CTAG 2 cut(s) 201, 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.