Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000374.1

Orthogroup ID

OG0010385

Physical Location & Seq

Genomic Coordinates Reverse (-)

30642 .. 31718

Gene Structure 1077 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000374.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 648 bp

atggagggaagcagcagcagcagcagcagctccatggtgataccagattcagtgatggagtcagtaaagagaagcatgggacatgtagaacaagtaggagccgagttgccccaattcttggctctctgttctgacccccaagtcctcgcccaattgccgcctcttcagcgtgcccactcacttctcttgctctccaatctcactaccactctattcaccctcaggttgaggtgcagtggagtatacgatgacgaccaccgcgtcaacaccgagcttgagaggttaaaattgtatcaggagaagctacagcgtttcatagatttgagcaaagcaccgttgcgaccatccaccactttaaattatcaggcagcaacccgtttcatcgagcattctctgccagacctcacccaagatcagaggcagggtatgagagatataagtaaagcggaggggaaaaagatgaagcatctggaaaggaatattcaaaagaagaggaagtatgaatcacctaacagacaatcagttcaatctgctgccaaggattttctagagaaagctgctcgtgagcttcttggtgatgacaatggtggtcttaagggacctctaagggctgagttctcagacagagataatctcaatttggactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03018 map03018

Pfam Domains

Protein Families

Sas10_Utp3

Protein Analysis

215

Amino Acids

24.27

Weight (kDa)

8.5

Isoelectric Point (pI)

48.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010385)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G25080
fragaria_vesca	FvH4_2g41170 FvH4_2g41170
malus_domestica	MD08G1055900.v1.1
prunus_persica	Prupe.1G394400_v2.0.a1 Prupe.1G394400_v2.0.a1 Prupe.1G394400_v2.0.a1 Prupe.1G394400_v2.0.a1 Prupe.1G394400_v2.0.a1
pyrus_communis	pycom08g04590
rosa_chinensis	RchiOBHm_Chr6g0299361
rosa_laevigata	RLG00000011439
rosa_multiflora	Rmu_sc0016112.1_g000001 Rmu_ssc0000374.1_g000002
rosa_roxburghii	Rroxscaffold_7G00168760
rosa_rugosa	Rorug06G0287400
rosa_samantha	Rh6AG399100 Rh6BG407500 Rh6CG413400 Rh6DG400300
rosa_wichuraiana	Rw6G034940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	140, 260
AccB7I	CCANNNNNTGG	1 cut(s)	118
AccI	GTMKAC	1 cut(s)	243
AccII	CGCG	1 cut(s)	261
AciI	CCGC	3 cut(s)	158, 259, 446
AcuI	CTGAAG	1 cut(s)	149
AfiI	CCNNNNNNNGG	1 cut(s)	118
AflII	CTTAAG	1 cut(s)	593
AflIII	ACRYGT	1 cut(s)	82
AgsI	TTSAA	2 cut(s)	485, 527
AluBI	AGCT	5 cut(s)	30, 274, 304, 557, 568
AluI	AGCT	5 cut(s)	30, 274, 304, 557, 568
ApeKI	GCWGC	9 cut(s)	12, 15, 18, 21, 24, 27, 368, 533, 557
AspS9I	GGNCC	1 cut(s)	599
AsuHPI	GGTGA	5 cut(s)	49, 208, 397, 498, 587
AvaII	GGWCC	1 cut(s)	599
AxyI	CCTNAGG	1 cut(s)	221
BaeGI	GKGCMC	1 cut(s)	175
BauI	CACGAG	1 cut(s)	561
BbvI	GCAGC	9 cut(s)	24, 27, 30, 33, 36, 39, 380, 520, 544
BccI	CCATC	2 cut(s)	49, 352
BfaI	CTAG	1 cut(s)	548
BfmI	CTRYAG	1 cut(s)	305
BfrI	CTTAAG	1 cut(s)	593
Bme18I	GGWCC	1 cut(s)	599
BmgT120I	GGNCC	1 cut(s)	599
BmiI	GGNNCC	2 cut(s)	100, 600
BmsI	GCATC	1 cut(s)	475
BplI	GAGNNNNNCTC	1 cut(s)	618
BpuEI	CTTGAG	1 cut(s)	296
BsaJI	CCNNGG	2 cut(s)	33, 537
Bsc4I	CCNNNNNNNGG	1 cut(s)	118
Bse21I	CCTNAGG	1 cut(s)	221
BseDI	CCNNGG	2 cut(s)	33, 537
BseGI	GGATG	1 cut(s)	344
BseLI	CCNNNNNNNGG	1 cut(s)	118
BseMII	CTCAG	3 cut(s)	235, 603, 633
BseSI	GKGCMC	1 cut(s)	175
BseXI	GCAGC	9 cut(s)	24, 27, 30, 33, 36, 39, 380, 520, 544
BsgI	GTGCAG	1 cut(s)	253
Bsh1236I	CGCG	1 cut(s)	261
BslFI	GGGAC	2 cut(s)	93, 612
BslI	CCNNNNNNNGG	1 cut(s)	118
BsmFI	GGGAC	2 cut(s)	93, 612
BsmI	GAATGC	1 cut(s)	388
Bsp1286I	GDGCHC	1 cut(s)	175
Bsp143I	GATC	1 cut(s)	412
Bsp19I	CCATGG	1 cut(s)	33
BspACI	CCGC	3 cut(s)	158, 259, 446
BspCNI	CTCAG	3 cut(s)	234, 604, 632
BspFNI	CGCG	1 cut(s)	261
BspLI	GGNNCC	2 cut(s)	100, 600
BspTI	CTTAAG	1 cut(s)	593
BssECI	CCNNGG	2 cut(s)	33, 537
BssMI	GATC	1 cut(s)	412
BssNAI	GTATAC	1 cut(s)	244
BssSI	CACGAG	1 cut(s)	561
BssT1I	CCWWGG	2 cut(s)	33, 537
Bst1107I	GTATAC	1 cut(s)	244
Bst2BI	CACGAG	1 cut(s)	561
Bst4CI	ACNGT	1 cut(s)	336
Bst6I	CTCTTC	2 cut(s)	168, 485
BstAFI	CTTAAG	1 cut(s)	593
BstAPI	GCANNNNNTGC	1 cut(s)	394
BstC8I	GCNNGC	1 cut(s)	171
BstDEI	CTNAG	4 cut(s)	221, 605, 612, 619
BstDSI	CCRYGG	1 cut(s)	33
BstF5I	GGATG	1 cut(s)	344
BstFNI	CGCG	1 cut(s)	261
BstKTI	GATC	1 cut(s)	415
BstMBI	GATC	1 cut(s)	412
BstMWI	GCNNNNNNNGC	6 cut(s)	18, 21, 24, 27, 166, 394
BstNSI	RCATGY	1 cut(s)	86
BstSFI	CTRYAG	1 cut(s)	305
BstSLI	GKGCMC	1 cut(s)	175
BstUI	CGCG	1 cut(s)	261
BstV1I	GCAGC	9 cut(s)	24, 27, 30, 33, 36, 39, 380, 520, 544
BstZ17I	GTATAC	1 cut(s)	244
Bsu36I	CCTNAGG	1 cut(s)	221
BtgI	CCRYGG	1 cut(s)	33
BtsCI	GGATG	1 cut(s)	344
BtsI	GCAGTG	1 cut(s)	241
BtsIMutI	CAGTG	2 cut(s)	57, 241
Cac8I	GCNNGC	1 cut(s)	171
Cfr13I	GGNCC	1 cut(s)	599
CseI	GACGC	1 cut(s)	250
CviAII	CATG	3 cut(s)	34, 76, 83
CviJI	RGCY	8 cut(s)	30, 101, 122, 274, 304, 557, 568, 611
CviKI_1	RGCY	8 cut(s)	30, 101, 122, 274, 304, 557, 568, 611
DdeI	CTNAG	4 cut(s)	221, 605, 612, 619
DpnI	GATC	1 cut(s)	414
DpnII	GATC	1 cut(s)	412
DraI	TTTAAA	1 cut(s)	357
DrdI	GACNNNNNNGTC	2 cut(s)	140, 260
DseDI	GACNNNNNNGTC	2 cut(s)	140, 260
Eam1104I	CTCTTC	2 cut(s)	168, 485
EarI	CTCTTC	2 cut(s)	168, 485
Eco130I	CCWWGG	2 cut(s)	33, 537
Eco47I	GGWCC	1 cut(s)	599
Eco57I	CTGAAG	1 cut(s)	149
Eco81I	CCTNAGG	1 cut(s)	221
EcoO109I	RGGNCCY	1 cut(s)	599
EcoT14I	CCWWGG	2 cut(s)	33, 537
ErhI	CCWWGG	2 cut(s)	33, 537
FaeI	CATG	3 cut(s)	37, 79, 86
FaiI	YATR	8 cut(s)	35, 77, 84, 244, 317, 428, 437, 501
FaqI	GGGAC	2 cut(s)	93, 612
FatI	CATG	3 cut(s)	33, 75, 82
FblI	GTMKAC	1 cut(s)	243
FokI	GGATG	1 cut(s)	331
FspBI	CTAG	1 cut(s)	548
HgaI	GACGC	1 cut(s)	250
Hin1II	CATG	3 cut(s)	37, 79, 86
HincII	GTYRAC	1 cut(s)	265
HindII	GTYRAC	1 cut(s)	265
HinfI	GANTC	3 cut(s)	47, 59, 503
HphI	GGTGA	5 cut(s)	49, 208, 397, 498, 587
Hpy166II	GTNNAC	2 cut(s)	244, 265
Hpy188I	TCNGA	3 cut(s)	133, 417, 622
Hpy188III	TCNNGA	4 cut(s)	296, 470, 548, 563
Hpy8I	GTNNAC	2 cut(s)	244, 265
HpyCH4III	ACNGT	1 cut(s)	336
HpyCH4V	TGCA	1 cut(s)	234
HpyF10VI	GCNNNNNNNGC	6 cut(s)	18, 21, 24, 27, 166, 394
HpyF3I	CTNAG	4 cut(s)	221, 605, 612, 619
Hsp92II	CATG	3 cut(s)	37, 79, 86
Kzo9I	GATC	1 cut(s)	412
LmnI	GCTCC	2 cut(s)	35, 98
LpnPI	CCDG	7 cut(s)	57, 208, 281, 350, 407, 411, 455
Lsp1109I	GCAGC	9 cut(s)	24, 27, 30, 33, 36, 39, 380, 520, 544
LweI	GCATC	1 cut(s)	475
MaeI	CTAG	1 cut(s)	548
MalI	GATC	1 cut(s)	414
MboI	GATC	1 cut(s)	412
MboII	GAAGA	2 cut(s)	155, 502
MfeI	CAATTG	1 cut(s)	152
MhlI	GDGCHC	1 cut(s)	175
MluCI	AATT	5 cut(s)	113, 152, 287, 358, 637
MlyI	GAGTC	1 cut(s)	68
MseI	TTAA	3 cut(s)	284, 356, 594
MspCI	CTTAAG	1 cut(s)	593
MunI	CAATTG	1 cut(s)	152
Mva1269I	GAATGC	1 cut(s)	388
MvnI	CGCG	1 cut(s)	261
MwoI	GCNNNNNNNGC	6 cut(s)	18, 21, 24, 27, 166, 394
NcoI	CCATGG	1 cut(s)	33
NdeII	GATC	1 cut(s)	412
NlaIII	CATG	3 cut(s)	37, 79, 86
NlaIV	GGNNCC	2 cut(s)	100, 600
NmeAIII	GCCGAG	1 cut(s)	127
NspI	RCATGY	1 cut(s)	86
PciI	ACATGT	1 cut(s)	82
PcsI	WCGNNNNNNNCGW	1 cut(s)	258
PctI	GAATGC	1 cut(s)	388
PfeI	GAWTC	2 cut(s)	47, 503
PflMI	CCANNNNNTGG	1 cut(s)	118
PleI	GAGTC	1 cut(s)	67
PpsI	GAGTC	1 cut(s)	67
PpuMI	RGGWCCY	1 cut(s)	599
PscI	ACATGT	1 cut(s)	82
Psp5II	RGGWCCY	1 cut(s)	599
PspN4I	GGNNCC	2 cut(s)	100, 600
PspPI	GGNCC	1 cut(s)	599
PspPPI	RGGWCCY	1 cut(s)	599
SaqAI	TTAA	3 cut(s)	284, 356, 594
Sau3AI	GATC	1 cut(s)	412
Sau96I	GGNCC	1 cut(s)	599
SchI	GAGTC	1 cut(s)	68
SduI	GDGCHC	1 cut(s)	175
SfaNI	GCATC	1 cut(s)	475
SfcI	CTRYAG	1 cut(s)	305
SinI	GGWCC	1 cut(s)	599
SmlI	CTYRAG	2 cut(s)	275, 593
SmoI	CTYRAG	2 cut(s)	275, 593
Sse9I	AATT	5 cut(s)	113, 152, 287, 358, 637
SsiI	CCGC	3 cut(s)	158, 259, 446
SspI	AATATT	1 cut(s)	481
SspMI	CTAG	1 cut(s)	548
StyI	CCWWGG	2 cut(s)	33, 537
TaaI	ACNGT	1 cut(s)	336
TaqI	TCGA	1 cut(s)	384
TasI	AATT	5 cut(s)	113, 152, 287, 358, 637
TauI	GCSGC	1 cut(s)	160
TfiI	GAWTC	2 cut(s)	47, 503
Tru1I	TTAA	3 cut(s)	284, 356, 594
Tru9I	TTAA	3 cut(s)	284, 356, 594
TscAI	CASTG	2 cut(s)	57, 241
TseI	GCWGC	9 cut(s)	12, 15, 18, 21, 24, 27, 368, 533, 557
TspDTI	ATGAA	4 cut(s)	304, 370, 476, 516
TspRI	CASTG	2 cut(s)	57, 241
Van91I	CCANNNNNTGG	1 cut(s)	118
Vha464I	CTTAAG	1 cut(s)	593
VpaK11BI	GGWCC	1 cut(s)	599
XbaI	TCTAGA	1 cut(s)	547
XceI	RCATGY	1 cut(s)	86
XmiI	GTMKAC	1 cut(s)	243
XspI	CTAG	1 cut(s)	548

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.