Rmu_ssc0000374.1_g000002

Nuclear nucleic acid-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000374.1
OG0010385
Physical Location & Seq
Reverse (-)
30642 .. 31718
1077 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 648 bp
atggagggaagcagcagcagcagcagcagctccatggtgataccagattcagtgatggagtcagtaaagagaagcatgggacatgtagaacaagtaggagccgagttgccccaattcttggctctctgttctgacccccaagtcctcgcccaattgccgcctcttcagcgtgcccactcacttctcttgctctccaatctcactaccactctattcaccctcaggttgaggtgcagtggagtatacgatgacgaccaccgcgtcaacaccgagcttgagaggttaaaattgtatcaggagaagctacagcgtttcatagatttgagcaaagcaccgttgcgaccatccaccactttaaattatcaggcagcaacccgtttcatcgagcattctctgccagacctcacccaagatcagaggcagggtatgagagatataagtaaagcggaggggaaaaagatgaagcatctggaaaggaatattcaaaagaagaggaagtatgaatcacctaacagacaatcagttcaatctgctgccaaggattttctagagaaagctgctcgtgagcttcttggtgatgacaatggtggtcttaagggacctctaagggctgagttctcagacagagataatctcaatttggactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03018 map03018
Pfam Domains
Protein Families
Sas10_Utp3

Protein Analysis

215

Amino Acids

24.27

Weight (kDa)

8.5

Isoelectric Point (pI)

48.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sas10_Utp3 PF04000 29 - 101 2.6e-07 Sas10/Utp3/C1D family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 140, 260
AccB7I CCANNNNNTGG 1 cut(s) 118
AccI GTMKAC 1 cut(s) 243
AccII CGCG 1 cut(s) 261
AciI CCGC 3 cut(s) 158, 259, 446
AcuI CTGAAG 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 118
AflII CTTAAG 1 cut(s) 593
AflIII ACRYGT 1 cut(s) 82
AgsI TTSAA 2 cut(s) 485, 527
AluBI AGCT 5 cut(s) 30, 274, 304, 557, 568
AluI AGCT 5 cut(s) 30, 274, 304, 557, 568
ApeKI GCWGC 9 cut(s) 12, 15, 18, 21, 24, 27, 368, 533, 557
AspS9I GGNCC 1 cut(s) 599
AsuHPI GGTGA 5 cut(s) 49, 208, 397, 498, 587
AvaII GGWCC 1 cut(s) 599
AxyI CCTNAGG 1 cut(s) 221
BaeGI GKGCMC 1 cut(s) 175
BauI CACGAG 1 cut(s) 561
BbvI GCAGC 9 cut(s) 24, 27, 30, 33, 36, 39, 380, 520, 544
BccI CCATC 2 cut(s) 49, 352
BfaI CTAG 1 cut(s) 548
BfmI CTRYAG 1 cut(s) 305
BfrI CTTAAG 1 cut(s) 593
Bme18I GGWCC 1 cut(s) 599
BmgT120I GGNCC 1 cut(s) 599
BmiI GGNNCC 2 cut(s) 100, 600
BmsI GCATC 1 cut(s) 475
BplI GAGNNNNNCTC 1 cut(s) 618
BpuEI CTTGAG 1 cut(s) 296
BsaJI CCNNGG 2 cut(s) 33, 537
Bsc4I CCNNNNNNNGG 1 cut(s) 118
Bse21I CCTNAGG 1 cut(s) 221
BseDI CCNNGG 2 cut(s) 33, 537
BseGI GGATG 1 cut(s) 344
BseLI CCNNNNNNNGG 1 cut(s) 118
BseMII CTCAG 3 cut(s) 235, 603, 633
BseSI GKGCMC 1 cut(s) 175
BseXI GCAGC 9 cut(s) 24, 27, 30, 33, 36, 39, 380, 520, 544
BsgI GTGCAG 1 cut(s) 253
Bsh1236I CGCG 1 cut(s) 261
BslFI GGGAC 2 cut(s) 93, 612
BslI CCNNNNNNNGG 1 cut(s) 118
BsmFI GGGAC 2 cut(s) 93, 612
BsmI GAATGC 1 cut(s) 388
Bsp1286I GDGCHC 1 cut(s) 175
Bsp143I GATC 1 cut(s) 412
Bsp19I CCATGG 1 cut(s) 33
BspACI CCGC 3 cut(s) 158, 259, 446
BspCNI CTCAG 3 cut(s) 234, 604, 632
BspFNI CGCG 1 cut(s) 261
BspLI GGNNCC 2 cut(s) 100, 600
BspTI CTTAAG 1 cut(s) 593
BssECI CCNNGG 2 cut(s) 33, 537
BssMI GATC 1 cut(s) 412
BssNAI GTATAC 1 cut(s) 244
BssSI CACGAG 1 cut(s) 561
BssT1I CCWWGG 2 cut(s) 33, 537
Bst1107I GTATAC 1 cut(s) 244
Bst2BI CACGAG 1 cut(s) 561
Bst4CI ACNGT 1 cut(s) 336
Bst6I CTCTTC 2 cut(s) 168, 485
BstAFI CTTAAG 1 cut(s) 593
BstAPI GCANNNNNTGC 1 cut(s) 394
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 4 cut(s) 221, 605, 612, 619
BstDSI CCRYGG 1 cut(s) 33
BstF5I GGATG 1 cut(s) 344
BstFNI CGCG 1 cut(s) 261
BstKTI GATC 1 cut(s) 415
BstMBI GATC 1 cut(s) 412
BstMWI GCNNNNNNNGC 6 cut(s) 18, 21, 24, 27, 166, 394
BstNSI RCATGY 1 cut(s) 86
BstSFI CTRYAG 1 cut(s) 305
BstSLI GKGCMC 1 cut(s) 175
BstUI CGCG 1 cut(s) 261
BstV1I GCAGC 9 cut(s) 24, 27, 30, 33, 36, 39, 380, 520, 544
BstZ17I GTATAC 1 cut(s) 244
Bsu36I CCTNAGG 1 cut(s) 221
BtgI CCRYGG 1 cut(s) 33
BtsCI GGATG 1 cut(s) 344
BtsI GCAGTG 1 cut(s) 241
BtsIMutI CAGTG 2 cut(s) 57, 241
Cac8I GCNNGC 1 cut(s) 171
Cfr13I GGNCC 1 cut(s) 599
CseI GACGC 1 cut(s) 250
CviAII CATG 3 cut(s) 34, 76, 83
CviJI RGCY 8 cut(s) 30, 101, 122, 274, 304, 557, 568, 611
CviKI_1 RGCY 8 cut(s) 30, 101, 122, 274, 304, 557, 568, 611
DdeI CTNAG 4 cut(s) 221, 605, 612, 619
DpnI GATC 1 cut(s) 414
DpnII GATC 1 cut(s) 412
DraI TTTAAA 1 cut(s) 357
DrdI GACNNNNNNGTC 2 cut(s) 140, 260
DseDI GACNNNNNNGTC 2 cut(s) 140, 260
Eam1104I CTCTTC 2 cut(s) 168, 485
EarI CTCTTC 2 cut(s) 168, 485
Eco130I CCWWGG 2 cut(s) 33, 537
Eco47I GGWCC 1 cut(s) 599
Eco57I CTGAAG 1 cut(s) 149
Eco81I CCTNAGG 1 cut(s) 221
EcoO109I RGGNCCY 1 cut(s) 599
EcoT14I CCWWGG 2 cut(s) 33, 537
ErhI CCWWGG 2 cut(s) 33, 537
FaeI CATG 3 cut(s) 37, 79, 86
FaiI YATR 8 cut(s) 35, 77, 84, 244, 317, 428, 437, 501
FaqI GGGAC 2 cut(s) 93, 612
FatI CATG 3 cut(s) 33, 75, 82
FblI GTMKAC 1 cut(s) 243
FokI GGATG 1 cut(s) 331
FspBI CTAG 1 cut(s) 548
HgaI GACGC 1 cut(s) 250
Hin1II CATG 3 cut(s) 37, 79, 86
HincII GTYRAC 1 cut(s) 265
HindII GTYRAC 1 cut(s) 265
HinfI GANTC 3 cut(s) 47, 59, 503
HphI GGTGA 5 cut(s) 49, 208, 397, 498, 587
Hpy166II GTNNAC 2 cut(s) 244, 265
Hpy188I TCNGA 3 cut(s) 133, 417, 622
Hpy188III TCNNGA 4 cut(s) 296, 470, 548, 563
Hpy8I GTNNAC 2 cut(s) 244, 265
HpyCH4III ACNGT 1 cut(s) 336
HpyCH4V TGCA 1 cut(s) 234
HpyF10VI GCNNNNNNNGC 6 cut(s) 18, 21, 24, 27, 166, 394
HpyF3I CTNAG 4 cut(s) 221, 605, 612, 619
Hsp92II CATG 3 cut(s) 37, 79, 86
Kzo9I GATC 1 cut(s) 412
LmnI GCTCC 2 cut(s) 35, 98
LpnPI CCDG 7 cut(s) 57, 208, 281, 350, 407, 411, 455
Lsp1109I GCAGC 9 cut(s) 24, 27, 30, 33, 36, 39, 380, 520, 544
LweI GCATC 1 cut(s) 475
MaeI CTAG 1 cut(s) 548
MalI GATC 1 cut(s) 414
MboI GATC 1 cut(s) 412
MboII GAAGA 2 cut(s) 155, 502
MfeI CAATTG 1 cut(s) 152
MhlI GDGCHC 1 cut(s) 175
MluCI AATT 5 cut(s) 113, 152, 287, 358, 637
MlyI GAGTC 1 cut(s) 68
MseI TTAA 3 cut(s) 284, 356, 594
MspCI CTTAAG 1 cut(s) 593
MunI CAATTG 1 cut(s) 152
Mva1269I GAATGC 1 cut(s) 388
MvnI CGCG 1 cut(s) 261
MwoI GCNNNNNNNGC 6 cut(s) 18, 21, 24, 27, 166, 394
NcoI CCATGG 1 cut(s) 33
NdeII GATC 1 cut(s) 412
NlaIII CATG 3 cut(s) 37, 79, 86
NlaIV GGNNCC 2 cut(s) 100, 600
NmeAIII GCCGAG 1 cut(s) 127
NspI RCATGY 1 cut(s) 86
PciI ACATGT 1 cut(s) 82
PcsI WCGNNNNNNNCGW 1 cut(s) 258
PctI GAATGC 1 cut(s) 388
PfeI GAWTC 2 cut(s) 47, 503
PflMI CCANNNNNTGG 1 cut(s) 118
PleI GAGTC 1 cut(s) 67
PpsI GAGTC 1 cut(s) 67
PpuMI RGGWCCY 1 cut(s) 599
PscI ACATGT 1 cut(s) 82
Psp5II RGGWCCY 1 cut(s) 599
PspN4I GGNNCC 2 cut(s) 100, 600
PspPI GGNCC 1 cut(s) 599
PspPPI RGGWCCY 1 cut(s) 599
SaqAI TTAA 3 cut(s) 284, 356, 594
Sau3AI GATC 1 cut(s) 412
Sau96I GGNCC 1 cut(s) 599
SchI GAGTC 1 cut(s) 68
SduI GDGCHC 1 cut(s) 175
SfaNI GCATC 1 cut(s) 475
SfcI CTRYAG 1 cut(s) 305
SinI GGWCC 1 cut(s) 599
SmlI CTYRAG 2 cut(s) 275, 593
SmoI CTYRAG 2 cut(s) 275, 593
Sse9I AATT 5 cut(s) 113, 152, 287, 358, 637
SsiI CCGC 3 cut(s) 158, 259, 446
SspI AATATT 1 cut(s) 481
SspMI CTAG 1 cut(s) 548
StyI CCWWGG 2 cut(s) 33, 537
TaaI ACNGT 1 cut(s) 336
TaqI TCGA 1 cut(s) 384
TasI AATT 5 cut(s) 113, 152, 287, 358, 637
TauI GCSGC 1 cut(s) 160
TfiI GAWTC 2 cut(s) 47, 503
Tru1I TTAA 3 cut(s) 284, 356, 594
Tru9I TTAA 3 cut(s) 284, 356, 594
TscAI CASTG 2 cut(s) 57, 241
TseI GCWGC 9 cut(s) 12, 15, 18, 21, 24, 27, 368, 533, 557
TspDTI ATGAA 4 cut(s) 304, 370, 476, 516
TspRI CASTG 2 cut(s) 57, 241
Van91I CCANNNNNTGG 1 cut(s) 118
Vha464I CTTAAG 1 cut(s) 593
VpaK11BI GGWCC 1 cut(s) 599
XbaI TCTAGA 1 cut(s) 547
XceI RCATGY 1 cut(s) 86
XmiI GTMKAC 1 cut(s) 243
XspI CTAG 1 cut(s) 548
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.