Rmu_ssc0000449.1_g000014

GDSL/SGNH-like Acyl-Esterase family found in Pmr5 and Cas1p

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000449.1
Physical Location & Seq
Forward (+)
95220 .. 96342
1123 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000449.1_g000014.1.cds

Sequence Viewer

Length: 681 bp
atgggttacctatccaaagctgcagctgctgctctgtttctaactctgcttctggtttcccaccaaacaaaagcagaggatttcaattccttgttcatcaataacaatgctacaaactcagacgaagtagtagctagaaaccttgcaggaggtaaatgcaactggttcagaggttcatgggtttacgacgcttcccattattctccctacgattccaactgtcccttcatagatccagagttcaactgtcaaaagtatggccgccccgataaatcttacctcaaatatcgatggcagcccttctcttgttcactgcccaggtttaatgggttgaatatgttacagcaatggagggggaagaagattatgtttgttggtgattcactgagtttgaaccagtggcaatccctaacatgtatgcttcattcttgggttccaaattccaagtacattttcaccccattaagaaatggcatagcgtcggtcacattccaggtcacccactattcactgctttttagtgttaatttcaccctctgggtcacgagcacagtgtatttcgtgccctggatcaccttgtacagtgttctgggtcaccatggtgacctgtacaatgtattttatgttctgagtaacgagcacagtgtatttcgtgaccaagagaatgaaaatatacactaa

Protein Analysis

226

Amino Acids

26.15

Weight (kDa)

8.23

Isoelectric Point (pI)

32.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 262
AclWI GGATC 2 cut(s) 227, 578
AcoI YGGCCR 1 cut(s) 259
AcsI RAATTY 1 cut(s) 439
AfaI GTAC 3 cut(s) 449, 581, 611
AflIII ACRYGT 1 cut(s) 413
AgsI TTSAA 4 cut(s) 85, 244, 334, 394
AjnI CCWGG 3 cut(s) 317, 492, 566
AjuI GAANNNNNNNTTGG 4 cut(s) 209, 241, 437, 469
AleI CACNNNNGTG 1 cut(s) 600
AluBI AGCT 3 cut(s) 20, 26, 134
AluI AGCT 3 cut(s) 20, 26, 134
Alw21I GWGCWC 2 cut(s) 551, 642
AlwI GGATC 2 cut(s) 227, 578
AlwNI CAGNNNCTG 1 cut(s) 29
AoxI GGCC 1 cut(s) 259
ApeKI GCWGC 5 cut(s) 20, 23, 26, 29, 295
ApoI RAATTY 1 cut(s) 439
AsuHPI GGTGA 7 cut(s) 389, 448, 490, 523, 565, 587, 614
BaeGI GKGCMC 1 cut(s) 567
BauI CACGAG 1 cut(s) 544
Bbv12I GWGCWC 2 cut(s) 551, 642
BbvI GCAGC 5 cut(s) 7, 13, 16, 35, 307
BccI CCATC 1 cut(s) 285
BciT130I CCWGG 3 cut(s) 319, 494, 568
BfaI CTAG 1 cut(s) 135
BfmI CTRYAG 1 cut(s) 21
BisI GCNGC 6 cut(s) 21, 24, 27, 30, 262, 296
BlsI GCNGC 6 cut(s) 22, 25, 28, 31, 263, 297
Bme1390I CCNGG 3 cut(s) 319, 494, 568
BmiI GGNNCC 1 cut(s) 435
BmrFI CCNGG 3 cut(s) 319, 494, 568
Bsa29I ATCGAT 1 cut(s) 289
BsaJI CCNNGG 3 cut(s) 317, 566, 598
Bse1I ACTGG 2 cut(s) 167, 397
Bse3DI GCAATG 1 cut(s) 353
BseBI CCWGG 3 cut(s) 319, 494, 568
BseCI ATCGAT 1 cut(s) 289
BseDI CCNNGG 3 cut(s) 317, 566, 598
BseMI GCAATG 1 cut(s) 353
BseMII CTCAG 3 cut(s) 132, 377, 620
BseNI ACTGG 2 cut(s) 167, 397
BseSI GKGCMC 1 cut(s) 567
BseXI GCAGC 5 cut(s) 7, 13, 16, 35, 307
BshFI GGCC 1 cut(s) 261
BshVI ATCGAT 1 cut(s) 289
BsiHKAI GWGCWC 2 cut(s) 551, 642
BslFI GGGAC 1 cut(s) 207
BsmFI GGGAC 1 cut(s) 207
BsnI GGCC 1 cut(s) 261
Bsp1286I GDGCHC 3 cut(s) 551, 567, 642
Bsp1407I TGTACA 2 cut(s) 579, 609
Bsp143I GATC 2 cut(s) 232, 570
Bsp19I CCATGG 1 cut(s) 598
BspACI CCGC 1 cut(s) 262
BspANI GGCC 1 cut(s) 261
BspCNI CTCAG 3 cut(s) 131, 378, 621
BspDI ATCGAT 1 cut(s) 289
BspLI GGNNCC 1 cut(s) 435
BspMAI CTGCAG 1 cut(s) 25
BspPI GGATC 2 cut(s) 227, 578
BsrDI GCAATG 1 cut(s) 353
BsrGI TGTACA 2 cut(s) 579, 609
BsrI ACTGG 2 cut(s) 167, 397
BssECI CCNNGG 3 cut(s) 317, 566, 598
BssMI GATC 2 cut(s) 232, 570
BssSI CACGAG 1 cut(s) 544
BssT1I CCWWGG 1 cut(s) 598
Bst2BI CACGAG 1 cut(s) 544
Bst2UI CCWGG 3 cut(s) 319, 494, 568
Bst4CI ACNGT 5 cut(s) 221, 248, 553, 584, 644
BstAPI GCANNNNNTGC 1 cut(s) 29
BstAUI TGTACA 2 cut(s) 579, 609
BstDEI CTNAG 3 cut(s) 118, 386, 629
BstDSI CCRYGG 1 cut(s) 598
BstEII GGTNACC 4 cut(s) 5, 496, 593, 602
BstKTI GATC 2 cut(s) 235, 573
BstMBI GATC 2 cut(s) 232, 570
BstMWI GCNNNNNNNGC 2 cut(s) 26, 29
BstNI CCWGG 3 cut(s) 319, 494, 568
BstNSI RCATGY 1 cut(s) 417
BstPI GGTNACC 4 cut(s) 5, 496, 593, 602
BstSCI CCNGG 3 cut(s) 317, 492, 566
BstSFI CTRYAG 1 cut(s) 21
BstSLI GKGCMC 1 cut(s) 567
BstV1I GCAGC 5 cut(s) 7, 13, 16, 35, 307
BstX2I RGATCY 1 cut(s) 232
BstYI RGATCY 1 cut(s) 232
Bsu15I ATCGAT 1 cut(s) 289
BsuRI GGCC 1 cut(s) 261
BsuTUI ATCGAT 1 cut(s) 289
BtgI CCRYGG 1 cut(s) 598
BtsI GCAGTG 2 cut(s) 311, 509
BtsIMutI CAGTG 7 cut(s) 311, 383, 404, 509, 558, 589, 649
CaiI CAGNNNCTG 1 cut(s) 29
ClaI ATCGAT 1 cut(s) 289
CseI GACGC 2 cut(s) 197, 468
Csp6I GTAC 3 cut(s) 448, 580, 610
CviAII CATG 3 cut(s) 177, 414, 599
CviJI RGCY 5 cut(s) 20, 26, 134, 261, 298
CviKI_1 RGCY 5 cut(s) 20, 26, 134, 261, 298
CviQI GTAC 3 cut(s) 448, 580, 610
DdeI CTNAG 3 cut(s) 118, 386, 629
DpnI GATC 2 cut(s) 234, 572
DpnII GATC 2 cut(s) 232, 570
EaeI YGGCCR 1 cut(s) 259
Eco130I CCWWGG 1 cut(s) 598
Eco91I GGTNACC 4 cut(s) 5, 496, 593, 602
EcoO65I GGTNACC 4 cut(s) 5, 496, 593, 602
EcoRII CCWGG 3 cut(s) 317, 492, 566
EcoT14I CCWWGG 1 cut(s) 598
ErhI CCWWGG 1 cut(s) 598
FaeI CATG 3 cut(s) 180, 417, 602
FaqI GGGAC 1 cut(s) 207
FatI CATG 3 cut(s) 176, 413, 598
Fnu4HI GCNGC 6 cut(s) 21, 24, 27, 30, 262, 296
Fsp4HI GCNGC 6 cut(s) 21, 24, 27, 30, 262, 296
FspBI CTAG 1 cut(s) 135
GluI GCNGC 6 cut(s) 21, 24, 27, 30, 262, 296
HaeIII GGCC 1 cut(s) 261
HgaI GACGC 2 cut(s) 197, 468
Hin1II CATG 3 cut(s) 180, 417, 602
HinfI GANTC 2 cut(s) 212, 380
HphI GGTGA 7 cut(s) 389, 448, 490, 523, 565, 587, 614
Hpy166II GTNNAC 2 cut(s) 184, 311
Hpy188I TCNGA 3 cut(s) 121, 170, 630
Hpy188III TCNNGA 3 cut(s) 236, 544, 653
Hpy8I GTNNAC 2 cut(s) 184, 311
Hpy99I CGWCG 2 cut(s) 191, 484
HpyAV CCTTC 2 cut(s) 235, 310
HpyCH4III ACNGT 5 cut(s) 221, 248, 553, 584, 644
HpyCH4V TGCA 3 cut(s) 23, 146, 159
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 29
HpyF3I CTNAG 3 cut(s) 118, 386, 629
Hsp92II CATG 3 cut(s) 180, 417, 602
Kzo9I GATC 2 cut(s) 232, 570
Lsp1109I GCAGC 5 cut(s) 7, 13, 16, 35, 307
MaeI CTAG 1 cut(s) 135
MaeIII GTNAC 9 cut(s) 5, 339, 484, 496, 541, 593, 602, 632, 653
MalI GATC 2 cut(s) 234, 572
MboI GATC 2 cut(s) 232, 570
MboII GAAGA 2 cut(s) 370, 373
MflI RGATCY 1 cut(s) 232
MhlI GDGCHC 3 cut(s) 551, 567, 642
MluCI AATT 3 cut(s) 85, 439, 526
MmeI TCCRAC 1 cut(s) 240
MnlI CCTC 6 cut(s) 70, 143, 164, 290, 345, 545
MseI TTAA 3 cut(s) 324, 464, 525
MslI CAYNNNNRTG 1 cut(s) 600
MspA1I CMGCKG 1 cut(s) 26
MspR9I CCNGG 3 cut(s) 319, 494, 568
MvaI CCWGG 3 cut(s) 319, 494, 568
MwoI GCNNNNNNNGC 2 cut(s) 26, 29
NcoI CCATGG 1 cut(s) 598
NdeII GATC 2 cut(s) 232, 570
NlaIII CATG 3 cut(s) 180, 417, 602
NlaIV GGNNCC 1 cut(s) 435
NmuCI GTSAC 6 cut(s) 484, 496, 541, 593, 602, 653
NspI RCATGY 1 cut(s) 417
OliI CACNNNNGTG 1 cut(s) 600
PciI ACATGT 1 cut(s) 413
PfeI GAWTC 2 cut(s) 212, 380
PkrI GCNGC 6 cut(s) 22, 25, 28, 31, 263, 297
PscI ACATGT 1 cut(s) 413
Psp6I CCWGG 3 cut(s) 317, 492, 566
PspEI GGTNACC 4 cut(s) 5, 496, 593, 602
PspGI CCWGG 3 cut(s) 317, 492, 566
PspN4I GGNNCC 1 cut(s) 435
PsrI GAACNNNNNNTAC 2 cut(s) 609, 641
PstI CTGCAG 1 cut(s) 25
PstNI CAGNNNCTG 1 cut(s) 29
PsuI RGATCY 1 cut(s) 232
PvuII CAGCTG 1 cut(s) 26
RsaI GTAC 3 cut(s) 449, 581, 611
RsaNI GTAC 3 cut(s) 448, 580, 610
RseI CAYNNNNRTG 1 cut(s) 600
SaqAI TTAA 3 cut(s) 324, 464, 525
SatI GCNGC 6 cut(s) 21, 24, 27, 30, 262, 296
Sau3AI GATC 2 cut(s) 232, 570
ScrFI CCNGG 3 cut(s) 319, 494, 568
SduI GDGCHC 3 cut(s) 551, 567, 642
SfcI CTRYAG 1 cut(s) 21
SmiMI CAYNNNNRTG 1 cut(s) 600
Sse9I AATT 3 cut(s) 85, 439, 526
SsiI CCGC 1 cut(s) 262
SspMI CTAG 1 cut(s) 135
StyD4I CCNGG 3 cut(s) 317, 492, 566
StyI CCWWGG 1 cut(s) 598
TaaI ACNGT 5 cut(s) 221, 248, 553, 584, 644
TaqI TCGA 1 cut(s) 289
TaqII GACCGA 1 cut(s) 472
TasI AATT 3 cut(s) 85, 439, 526
TatI WGTACW 3 cut(s) 447, 579, 609
TauI GCSGC 1 cut(s) 264
TfiI GAWTC 2 cut(s) 212, 380
Tru1I TTAA 3 cut(s) 324, 464, 525
Tru9I TTAA 3 cut(s) 324, 464, 525
TscAI CASTG 7 cut(s) 318, 390, 404, 516, 558, 589, 649
TseFI GTSAC 6 cut(s) 484, 496, 541, 593, 602, 653
TseI GCWGC 5 cut(s) 20, 23, 26, 29, 295
Tsp45I GTSAC 6 cut(s) 484, 496, 541, 593, 602, 653
TspDTI ATGAA 5 cut(s) 85, 165, 217, 413, 681
TspRI CASTG 7 cut(s) 318, 390, 404, 516, 558, 589, 649
XapI RAATTY 1 cut(s) 439
XceI RCATGY 1 cut(s) 417
XspI CTAG 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.