Rroxscaffold_3G00233860

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
20178804 .. 20182290
3487 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00233860.1

Sequence Viewer

Length: 330 bp
ATGTTTCTTTTCCCTTTCCAATCCCATTGTATTTCGTGTAAAAAAATGGCACATAAAGTTAATAAAATCAACACATCTTTGGAGAAGTTGATTATTATGGCAAGTGCTATTGGGTTAAGTGCTAGGCCGTCCATAGATGCAATAAGCTCCAATGGTCAAAGAATTGACCGGGAAACATACTCTCATTTTGAGCAAGATGAAAACAATATCATTGGAAGGAAAGAGGTTGTGTCGGATATAGTGAAAGTCTTGACAGCCTCAAACAACAATTATCTTTCTATTATGGCCATCGTAGGAATGGCGAGGGATTGGAAAGACAACTTTGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.23

Weight (kDa)

8.64

Isoelectric Point (pI)

33.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 285
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
AoxI GGCC 2 cut(s) 125, 285
AsuC2I CCSGG 1 cut(s) 170
BalI TGGCCA 1 cut(s) 287
BccI CCATC 1 cut(s) 296
BceAI ACGGC 1 cut(s) 112
BcnI CCSGG 1 cut(s) 170
BfaI CTAG 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 170
BmrFI CCNGG 1 cut(s) 170
BmsI GCATC 1 cut(s) 127
BpuMI CCSGG 1 cut(s) 170
BshFI GGCC 2 cut(s) 127, 287
BsiSI CCGG 1 cut(s) 169
BsnI GGCC 2 cut(s) 127, 287
BspANI GGCC 2 cut(s) 127, 287
BstSCI CCNGG 1 cut(s) 168
BsuRI GGCC 2 cut(s) 127, 287
CviJI RGCY 5 cut(s) 127, 147, 257, 287, 327
CviKI_1 RGCY 5 cut(s) 127, 147, 257, 287, 327
EaeI YGGCCR 1 cut(s) 285
FaiI YATR 6 cut(s) 54, 98, 134, 178, 239, 284
FspBI CTAG 1 cut(s) 123
HaeIII GGCC 2 cut(s) 127, 287
HapII CCGG 1 cut(s) 169
HpaII CCGG 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 235
Hpy188III TCNNGA 1 cut(s) 250
HpyAV CCTTC 1 cut(s) 210
HpyCH4V TGCA 1 cut(s) 140
LmnI GCTCC 1 cut(s) 152
LpnPI CCDG 1 cut(s) 182
LweI GCATC 1 cut(s) 127
MaeI CTAG 1 cut(s) 123
MlsI TGGCCA 1 cut(s) 287
MluCI AATT 2 cut(s) 162, 268
MluNI TGGCCA 1 cut(s) 287
MmeI TCCRAC 1 cut(s) 213
MnlI CCTC 3 cut(s) 217, 268, 297
Mox20I TGGCCA 1 cut(s) 287
MscI TGGCCA 1 cut(s) 287
MseI TTAA 2 cut(s) 60, 116
Msp20I TGGCCA 1 cut(s) 287
MspI CCGG 1 cut(s) 169
MspR9I CCNGG 1 cut(s) 170
NciI CCSGG 1 cut(s) 170
SaqAI TTAA 2 cut(s) 60, 116
ScrFI CCNGG 1 cut(s) 170
SetI ASST 2 cut(s) 149, 228
SfaNI GCATC 1 cut(s) 127
SgeI CNNG 8 cut(s) 48, 114, 135, 181, 182, 206, 262, 315
Sse9I AATT 2 cut(s) 162, 268
SspMI CTAG 1 cut(s) 123
StyD4I CCNGG 1 cut(s) 168
TasI AATT 2 cut(s) 162, 268
Tru1I TTAA 2 cut(s) 60, 116
Tru9I TTAA 2 cut(s) 60, 116
TspDTI ATGAA 1 cut(s) 213
XcmI CCANNNNNNNNNTGG 1 cut(s) 295
XspI CTAG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.