Rroxscaffold_5G00385810

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
64798850 .. 64799205
356 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00385810.1

Sequence Viewer

Length: 264 bp
ATGCCCAACATACACATCAAGATCGGGAGAGGTCGTGAAACTCGGGTGAAGGAGCTTGAAGATGTAGCTCATGTGCCGATGAGGTGTTGGATGACTACGGCTATGAACTCGCTCCAGGGTAAGGTGGAACTGTGCAACCAGTTAAAGAAAAAGAAATTGATTAATATGGCAAGTGCTATTGGGTTGAGTGCTAAGCCGTCCATAGATGCAATAAGCTCCAATGGTCAAAGAATTGATCGGGAAACATACTCTCATTTTGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.82

Weight (kDa)

9.56

Isoelectric Point (pI)

30.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 121
AgsI TTSAA 1 cut(s) 59
AjnI CCWGG 1 cut(s) 114
AluBI AGCT 3 cut(s) 55, 68, 216
AluI AGCT 3 cut(s) 55, 68, 216
Ama87I CYCGRG 1 cut(s) 42
AseI ATTAAT 1 cut(s) 162
AsuHPI GGTGA 1 cut(s) 58
AvaI CYCGRG 1 cut(s) 42
BceAI ACGGC 2 cut(s) 114, 181
BciT130I CCWGG 1 cut(s) 116
BlpI GCTNAGC 1 cut(s) 192
Bme1390I CCNGG 1 cut(s) 116
BmeT110I CYCGRG 1 cut(s) 42
BmrFI CCNGG 1 cut(s) 116
BmsI GCATC 1 cut(s) 196
BpmI CTGGAG 1 cut(s) 98
Bpu1102I GCTNAGC 1 cut(s) 192
BsaJI CCNNGG 1 cut(s) 115
BsaXI ACNNNNNCTCC 2 cut(s) 19, 49
Bsc4I CCNNNNNNNGG 1 cut(s) 121
Bse1I ACTGG 1 cut(s) 139
BseBI CCWGG 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 115
BseGI GGATG 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 121
BseNI ACTGG 1 cut(s) 139
BsiHKCI CYCGRG 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 121
BsoBI CYCGRG 1 cut(s) 42
Bsp143I GATC 2 cut(s) 21, 235
Bsp1720I GCTNAGC 1 cut(s) 192
BsrI ACTGG 1 cut(s) 139
BssECI CCNNGG 1 cut(s) 115
BssMI GATC 2 cut(s) 21, 235
Bst2UI CCWGG 1 cut(s) 116
Bst4CI ACNGT 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 192
BstF5I GGATG 1 cut(s) 96
BstKTI GATC 2 cut(s) 24, 238
BstMBI GATC 2 cut(s) 21, 235
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BtsCI GGATG 1 cut(s) 96
CviAII CATG 1 cut(s) 71
CviJI RGCY 5 cut(s) 55, 68, 101, 196, 216
CviKI_1 RGCY 5 cut(s) 55, 68, 101, 196, 216
DdeI CTNAG 1 cut(s) 192
DpnI GATC 2 cut(s) 23, 237
DpnII GATC 2 cut(s) 21, 235
Eco88I CYCGRG 1 cut(s) 42
EcoRII CCWGG 1 cut(s) 114
FaeI CATG 1 cut(s) 74
FaiI YATR 6 cut(s) 11, 72, 104, 167, 203, 247
FatI CATG 1 cut(s) 70
FokI GGATG 1 cut(s) 103
GsuI CTGGAG 1 cut(s) 98
Hin1II CATG 1 cut(s) 74
HphI GGTGA 1 cut(s) 58
Hpy188III TCNNGA 4 cut(s) 19, 25, 35, 239
HpyAV CCTTC 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 132
HpyCH4V TGCA 2 cut(s) 135, 209
HpyF3I CTNAG 1 cut(s) 192
Hsp92II CATG 1 cut(s) 74
Kzo9I GATC 2 cut(s) 21, 235
LmnI GCTCC 3 cut(s) 52, 117, 221
LpnPI CCDG 3 cut(s) 101, 128, 152
LweI GCATC 1 cut(s) 196
MalI GATC 2 cut(s) 23, 237
MboI GATC 2 cut(s) 21, 235
MboII GAAGA 1 cut(s) 71
MluCI AATT 2 cut(s) 155, 231
MmeI TCCRAC 1 cut(s) 68
MnlI CCTC 2 cut(s) 23, 75
MseI TTAA 2 cut(s) 143, 162
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
NdeII GATC 2 cut(s) 21, 235
NlaIII CATG 1 cut(s) 74
PshBI ATTAAT 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
SaqAI TTAA 2 cut(s) 143, 162
Sau3AI GATC 2 cut(s) 21, 235
ScrFI CCNGG 1 cut(s) 116
SetI ASST 6 cut(s) 34, 57, 70, 86, 126, 218
SfaNI GCATC 1 cut(s) 196
Sse9I AATT 2 cut(s) 155, 231
StyD4I CCNGG 1 cut(s) 114
TaaI ACNGT 1 cut(s) 132
TasI AATT 2 cut(s) 155, 231
Tru1I TTAA 2 cut(s) 143, 162
Tru9I TTAA 2 cut(s) 143, 162
TspDTI ATGAA 1 cut(s) 119
VspI ATTAAT 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.