Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000005

Orthogroup ID

OG0002934

Physical Location & Seq

Genomic Coordinates Reverse (-)

20036547 .. 20036900

Gene Structure 354 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_5G00348130.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

ATGTGGAAGAGACTAGTGCGTCGAAGGATTGGTGTTCTTTGCCAAAAGTGGGATGGACATGAGGAATTATTCAACGATATATGTTCCAACTTGGGTGTGATGTTGGTGGTATCCTCAAAAGAAAAAGAAAAAGTTACTGCAAGTGAGGTCTTAGCTAGTGGTCCACGACCTCGGCCCACGATGGGAACTGTCATTATTACTCTCATGCATCTTGCTTTGCAAAGTGAGAAAATAGAGTTGGAGGCTGTATTCATGATATGCGTGGTTGCTGCTATTGATCCTTGTCGGAGGGAATTGATCTTTGTAATACTTGACAATCTCTCAAGGCAGCTGGACTATGCAAGCAGGTTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko01524 ko03440 ko04064 ko04068 ko04110 ko04115 ko04210 ko04214 ko04218 ko05165 ko05166 ko05202 ko05206 map01524 map03440 map04064 map04068 map04110 map04115 map04210 map04214 map04218 map05165 map05166 map05202 map05206

Pfam Domains

Protein Families

FAT FATC PI3_PI4_kinase PWWP

Protein Analysis

117

Amino Acids

13.34

Weight (kDa)

8.43

Isoelectric Point (pI)

56.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002934)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G48190 AT3G48190 AT3G48190
fragaria_vesca	FvH4_2g11670
malus_domestica	MD06G1173700.v1.1
prunus_persica	Prupe.5G173600_v2.0.a1 Prupe.5G173600_v2.0.a1 Prupe.5G173600_v2.0.a1 Prupe.5G173600_v2.0.a1 Prupe.5G173600_v2.0.a1 Prupe.5G173600_v2.0.a1 Prupe.5G173600_v2.0.a1 Prupe.5G173600_v2.0.a1 Prupe.5G173600_v2.0.a1
pyrus_communis	pycom05g15080 pycom06g15490 pycom16g13670
rosa_chinensis	RchiOBHm_Chr6g0271131
rosa_laevigata	RLG00000013743
rosa_multiflora	Rmu_sc0004675.1_g000002
rosa_roxburghii	Rroxscaffold_3G00233860 Rroxscaffold_4G00324410 Rroxscaffold_4G00324420 Rroxscaffold_5G00346090 Rroxscaffold_5G00348130 Rroxscaffold_5G00348580 Rroxscaffold_5G00348590 Rroxscaffold_5G00385810 Rroxscaffold_6G00394020 Rroxscaffold_7G00197250 Rroxscaffold_8G00436820
rosa_rugosa	Rorug06G0058900
rosa_samantha	Rh6AG178600 Rh6BG182100 Rh6CG177800 Rh6DG169700
rosa_wichuraiana	Rw6G015260 Rw6G015300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	18
Acc36I	ACCTGC	1 cut(s)	336
AclWI	GGATC	1 cut(s)	272
AfiI	CCNNNNNNNGG	2 cut(s)	49, 182
AgsI	TTSAA	1 cut(s)	73
AhlI	ACTAGT	1 cut(s)	13
AjuI	GAANNNNNNNTTGG	2 cut(s)	221, 253
AluBI	AGCT	2 cut(s)	155, 331
AluI	AGCT	2 cut(s)	155, 331
Alw26I	GTCTC	1 cut(s)	4
AlwI	GGATC	1 cut(s)	272
AoxI	GGCC	1 cut(s)	173
ApeKI	GCWGC	2 cut(s)	269, 328
AspS9I	GGNCC	2 cut(s)	161, 174
AvaII	GGWCC	1 cut(s)	161
BbvI	GCAGC	2 cut(s)	256, 340
BccI	CCATC	2 cut(s)	47, 175
BciVI	GTATCC	1 cut(s)	121
BcoDI	GTCTC	1 cut(s)	4
BcuI	ACTAGT	1 cut(s)	13
BfaI	CTAG	2 cut(s)	14, 156
BfuAI	ACCTGC	1 cut(s)	336
BfuI	GTATCC	1 cut(s)	121
BisI	GCNGC	2 cut(s)	270, 329
BlsI	GCNGC	2 cut(s)	271, 330
Bme18I	GGWCC	1 cut(s)	161
BmgT120I	GGNCC	2 cut(s)	161, 174
BmsI	GCATC	1 cut(s)	217
BpuEI	CTTGAG	1 cut(s)	307
BsaJI	CCNNGG	1 cut(s)	170
Bsc4I	CCNNNNNNNGG	2 cut(s)	49, 182
BseDI	CCNNGG	1 cut(s)	170
BseGI	GGATG	1 cut(s)	58
BseLI	CCNNNNNNNGG	2 cut(s)	49, 182
BseXI	GCAGC	2 cut(s)	256, 340
BshFI	GGCC	1 cut(s)	175
BslI	CCNNNNNNNGG	2 cut(s)	49, 182
BsmAI	GTCTC	1 cut(s)	4
BsnI	GGCC	1 cut(s)	175
Bsp143I	GATC	2 cut(s)	277, 297
BspANI	GGCC	1 cut(s)	175
BspHI	TCATGA	1 cut(s)	252
BspMI	ACCTGC	1 cut(s)	336
BspPI	GGATC	1 cut(s)	272
BssECI	CCNNGG	1 cut(s)	170
BssMI	GATC	2 cut(s)	277, 297
Bst4CI	ACNGT	1 cut(s)	190
Bst6I	CTCTTC	1 cut(s)	2
BstC8I	GCNNGC	1 cut(s)	343
BstDEI	CTNAG	1 cut(s)	151
BstF5I	GGATG	1 cut(s)	58
BstKTI	GATC	2 cut(s)	280, 300
BstMAI	GTCTC	1 cut(s)	4
BstMBI	GATC	2 cut(s)	277, 297
BstV1I	GCAGC	2 cut(s)	256, 340
BsuI	GTATCC	1 cut(s)	121
BsuRI	GGCC	1 cut(s)	175
BtsCI	GGATG	1 cut(s)	58
BveI	ACCTGC	1 cut(s)	336
Cac8I	GCNNGC	1 cut(s)	343
CciI	TCATGA	1 cut(s)	252
Cfr13I	GGNCC	2 cut(s)	161, 174
CseI	GACGC	1 cut(s)	8
CviAII	CATG	3 cut(s)	59, 205, 253
CviJI	RGCY	4 cut(s)	155, 175, 245, 331
CviKI_1	RGCY	4 cut(s)	155, 175, 245, 331
DdeI	CTNAG	1 cut(s)	151
DpnI	GATC	2 cut(s)	279, 299
DpnII	GATC	2 cut(s)	277, 297
DrdI	GACNNNNNNGTC	1 cut(s)	18
DseDI	GACNNNNNNGTC	1 cut(s)	18
Eam1104I	CTCTTC	1 cut(s)	2
EarI	CTCTTC	1 cut(s)	2
Eco47I	GGWCC	1 cut(s)	161
EcoT22I	ATGCAT	1 cut(s)	210
FaeI	CATG	3 cut(s)	62, 208, 256
FaiI	YATR	7 cut(s)	60, 80, 82, 206, 254, 259, 339
FatI	CATG	3 cut(s)	58, 204, 252
Fnu4HI	GCNGC	2 cut(s)	270, 329
FokI	GGATG	1 cut(s)	65
Fsp4HI	GCNGC	2 cut(s)	270, 329
FspBI	CTAG	2 cut(s)	14, 156
GluI	GCNGC	2 cut(s)	270, 329
HaeIII	GGCC	1 cut(s)	175
HgaI	GACGC	1 cut(s)	8
Hin1II	CATG	3 cut(s)	62, 208, 256
Hpy166II	GTNNAC	1 cut(s)	164
Hpy188I	TCNGA	1 cut(s)	288
Hpy188III	TCNNGA	1 cut(s)	253
Hpy8I	GTNNAC	1 cut(s)	164
Hpy99I	CGWCG	1 cut(s)	24
HpyAV	CCTTC	1 cut(s)	18
HpyCH4III	ACNGT	1 cut(s)	190
HpyCH4V	TGCA	4 cut(s)	140, 208, 220, 341
HpyF3I	CTNAG	1 cut(s)	151
Hsp92II	CATG	3 cut(s)	62, 208, 256
Kzo9I	GATC	2 cut(s)	277, 297
LpnPI	CCDG	2 cut(s)	317, 331
Lsp1109I	GCAGC	2 cut(s)	256, 340
LweI	GCATC	1 cut(s)	217
MaeI	CTAG	2 cut(s)	14, 156
MaeIII	GTNAC	1 cut(s)	133
MalI	GATC	2 cut(s)	279, 299
MboI	GATC	2 cut(s)	277, 297
MboII	GAAGA	1 cut(s)	19
MluCI	AATT	2 cut(s)	65, 293
MmeI	TCCRAC	3 cut(s)	111, 219, 266
MnlI	CCTC	6 cut(s)	55, 124, 139, 180, 235, 282
Mph1103I	ATGCAT	1 cut(s)	210
MspA1I	CMGCKG	1 cut(s)	331
NdeII	GATC	2 cut(s)	277, 297
NlaIII	CATG	3 cut(s)	62, 208, 256
NmeAIII	GCCGAG	1 cut(s)	151
NsiI	ATGCAT	1 cut(s)	210
PagI	TCATGA	1 cut(s)	252
PkrI	GCNGC	2 cut(s)	271, 330
PspPI	GGNCC	2 cut(s)	161, 174
PvuII	CAGCTG	1 cut(s)	331
SatI	GCNGC	2 cut(s)	270, 329
Sau3AI	GATC	2 cut(s)	277, 297
Sau96I	GGNCC	2 cut(s)	161, 174
SetI	ASST	5 cut(s)	150, 157, 172, 333, 350
SfaNI	GCATC	1 cut(s)	217
SinI	GGWCC	1 cut(s)	161
SmlI	CTYRAG	1 cut(s)	322
SmoI	CTYRAG	1 cut(s)	322
SpeI	ACTAGT	1 cut(s)	13
Sse9I	AATT	2 cut(s)	65, 293
SspMI	CTAG	2 cut(s)	14, 156
TaaI	ACNGT	1 cut(s)	190
TaqI	TCGA	1 cut(s)	22
TasI	AATT	2 cut(s)	65, 293
TseI	GCWGC	2 cut(s)	269, 328
TspDTI	ATGAA	1 cut(s)	241
VpaK11BI	GGWCC	1 cut(s)	161
XcmI	CCANNNNNNNNNTGG	1 cut(s)	50
XspI	CTAG	2 cut(s)	14, 156
Zsp2I	ATGCAT	1 cut(s)	210

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.