Rroxscaffold_3G00238180

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0016970
Physical Location & Seq
Forward (+)
26360395 .. 26361931
1537 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00238180.1

Sequence Viewer

Length: 315 bp
ATGGCCAGCGTTGGTATGGACACCAAAGTCGATGGCTTGGCTGATCGGATTCTTAATCCAGGGAGGTTGGGCTGGTGCGGGGTCCACTTCACTACTCTGTTGGGCCAGATTTCTCTATGGGCTTGGATTTGGGACCCTAGAGATCTTGTGCATGATTTTTGGTTCAATTACACTTTTAGTGCTTCTCGATCTAGTATCTTGATTGATTTTGTAAGTGGTGATAGCCTATTGGCATCTGCAGATGGTCTCTTATTGCACGGAGAGTTCCAGGGAAAACAGACATTGAAATCAAGAATCACTGGAACACTGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.5

Weight (kDa)

5.78

Isoelectric Point (pI)

15.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 26
AciI CCGC 1 cut(s) 78
AcoI YGGCCR 1 cut(s) 3
AgsI TTSAA 2 cut(s) 166, 286
AjnI CCWGG 2 cut(s) 58, 267
Alw26I GTCTC 1 cut(s) 251
AoxI GGCC 2 cut(s) 3, 103
AspS9I GGNCC 3 cut(s) 82, 103, 133
AsuHPI GGTGA 1 cut(s) 230
AvaII GGWCC 2 cut(s) 82, 133
BalI TGGCCA 1 cut(s) 5
BccI CCATC 2 cut(s) 26, 236
BciT130I CCWGG 2 cut(s) 60, 269
BcoDI GTCTC 1 cut(s) 251
BfaI CTAG 2 cut(s) 138, 192
BfmI CTRYAG 1 cut(s) 237
BglII AGATCT 1 cut(s) 142
Bme1390I CCNGG 2 cut(s) 60, 269
Bme18I GGWCC 2 cut(s) 82, 133
BmgT120I GGNCC 3 cut(s) 82, 103, 133
BmiI GGNNCC 3 cut(s) 83, 134, 135
BmrFI CCNGG 2 cut(s) 60, 269
BmsI GCATC 1 cut(s) 242
BsaI GGTCTC 1 cut(s) 251
BsaJI CCNNGG 2 cut(s) 59, 268
Bse1I ACTGG 1 cut(s) 304
BseBI CCWGG 2 cut(s) 60, 269
BseDI CCNNGG 2 cut(s) 59, 268
BseNI ACTGG 1 cut(s) 304
BshFI GGCC 2 cut(s) 5, 105
BslFI GGGAC 1 cut(s) 146
BsmAI GTCTC 1 cut(s) 251
BsmFI GGGAC 1 cut(s) 146
BsnI GGCC 2 cut(s) 5, 105
Bso31I GGTCTC 1 cut(s) 251
Bsp143I GATC 3 cut(s) 43, 142, 188
BspACI CCGC 1 cut(s) 78
BspANI GGCC 2 cut(s) 5, 105
BspLI GGNNCC 3 cut(s) 83, 134, 135
BspMAI CTGCAG 1 cut(s) 241
BspTNI GGTCTC 1 cut(s) 251
BsrI ACTGG 1 cut(s) 304
BssECI CCNNGG 2 cut(s) 59, 268
BssMI GATC 3 cut(s) 43, 142, 188
Bst2UI CCWGG 2 cut(s) 60, 269
Bst4CI ACNGT 1 cut(s) 309
BstC8I GCNNGC 1 cut(s) 7
BstKTI GATC 3 cut(s) 46, 145, 191
BstMAI GTCTC 1 cut(s) 251
BstMBI GATC 3 cut(s) 43, 142, 188
BstNI CCWGG 2 cut(s) 60, 269
BstSCI CCNGG 2 cut(s) 58, 267
BstSFI CTRYAG 1 cut(s) 237
BstX2I RGATCY 1 cut(s) 142
BstYI RGATCY 1 cut(s) 142
BsuRI GGCC 2 cut(s) 5, 105
BtsIMutI CAGTG 2 cut(s) 297, 305
Cac8I GCNNGC 1 cut(s) 7
Cfr13I GGNCC 3 cut(s) 82, 103, 133
CviAII CATG 1 cut(s) 152
CviJI RGCY 7 cut(s) 5, 36, 41, 72, 105, 122, 225
CviKI_1 RGCY 7 cut(s) 5, 36, 41, 72, 105, 122, 225
DpnI GATC 3 cut(s) 45, 144, 190
DpnII GATC 3 cut(s) 43, 142, 188
DrdI GACNNNNNNGTC 1 cut(s) 26
DseDI GACNNNNNNGTC 1 cut(s) 26
EaeI YGGCCR 1 cut(s) 3
Eco31I GGTCTC 1 cut(s) 251
Eco47I GGWCC 2 cut(s) 82, 133
EcoO109I RGGNCCY 1 cut(s) 133
EcoRII CCWGG 2 cut(s) 58, 267
FaeI CATG 1 cut(s) 155
FaiI YATR 4 cut(s) 17, 118, 153, 313
FaqI GGGAC 1 cut(s) 146
FatI CATG 1 cut(s) 151
FauI CCCGC 1 cut(s) 71
FspBI CTAG 2 cut(s) 138, 192
HaeIII GGCC 2 cut(s) 5, 105
Hin1II CATG 1 cut(s) 155
HinfI GANTC 2 cut(s) 49, 294
HphI GGTGA 1 cut(s) 230
Hpy166II GTNNAC 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 48
Hpy188III TCNNGA 3 cut(s) 186, 199, 291
Hpy8I GTNNAC 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 309
HpyCH4V TGCA 3 cut(s) 151, 239, 256
Hsp92II CATG 1 cut(s) 155
KflI GGGWCCC 1 cut(s) 133
Kzo9I GATC 3 cut(s) 43, 142, 188
LpnPI CCDG 8 cut(s) 19, 45, 58, 72, 119, 254, 281, 285
LweI GCATC 1 cut(s) 242
MaeI CTAG 2 cut(s) 138, 192
MalI GATC 3 cut(s) 45, 144, 190
MboI GATC 3 cut(s) 43, 142, 188
MflI RGATCY 1 cut(s) 142
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 166
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 57
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 54
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 2 cut(s) 60, 269
MvaI CCWGG 2 cut(s) 60, 269
NdeII GATC 3 cut(s) 43, 142, 188
NlaIII CATG 1 cut(s) 155
NlaIV GGNNCC 3 cut(s) 83, 134, 135
PfeI GAWTC 2 cut(s) 49, 294
PpuMI RGGWCCY 1 cut(s) 133
Psp5II RGGWCCY 1 cut(s) 133
Psp6I CCWGG 2 cut(s) 58, 267
PspGI CCWGG 2 cut(s) 58, 267
PspN4I GGNNCC 3 cut(s) 83, 134, 135
PspPI GGNCC 3 cut(s) 82, 103, 133
PspPPI RGGWCCY 1 cut(s) 133
PstI CTGCAG 1 cut(s) 241
PsuI RGATCY 1 cut(s) 142
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 3 cut(s) 43, 142, 188
Sau96I GGNCC 3 cut(s) 82, 103, 133
ScrFI CCNGG 2 cut(s) 60, 269
SetI ASST 1 cut(s) 68
SfaNI GCATC 1 cut(s) 242
SfcI CTRYAG 1 cut(s) 237
SinI GGWCC 2 cut(s) 82, 133
Sse9I AATT 1 cut(s) 166
SsiI CCGC 1 cut(s) 78
SspMI CTAG 2 cut(s) 138, 192
StyD4I CCNGG 2 cut(s) 58, 267
TaaI ACNGT 1 cut(s) 309
TaqI TCGA 2 cut(s) 30, 187
TasI AATT 1 cut(s) 166
TfiI GAWTC 2 cut(s) 49, 294
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 2 cut(s) 304, 312
TspGWI ACGGA 1 cut(s) 273
TspRI CASTG 2 cut(s) 304, 312
VpaK11BI GGWCC 2 cut(s) 82, 133
XcmI CCANNNNNNNNNTGG 1 cut(s) 13
XspI CTAG 2 cut(s) 138, 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.