Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000003

Orthogroup ID

OG0011625

Physical Location & Seq

Genomic Coordinates Reverse (-)

46326031 .. 46327911

Gene Structure 1881 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_3G00252300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 156 bp

ATGAAGATTCAAACTATTCAAGCATGGGGATGGTATATCCGCTTACTAGGGTCTCATGCCTTGAAGAACAGACATTTAATTAATAATATGCTGAAAATTCCCAAGAAAACATTTTCAGATAACGACTCACAAGTTCAGATTGCTTCCCAGATATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04550 map04550

Pfam Domains

Protein Families

Rif1_N

Protein Analysis

51

Amino Acids

5.95

Weight (kDa)

10.29

Isoelectric Point (pI)

19.01

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Rif1_N	PF12231	4 - 50	6.8e-06	Rap1-interacting factor 1 N terminal

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011625)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000007912
rosa_roxburghii	Rroxscaffold_1G00013790 Rroxscaffold_3G00218570 Rroxscaffold_3G00218580 Rroxscaffold_3G00252300 Rroxscaffold_6G00425440 Rroxscaffold_7G00199340
rosa_rugosa	Rorug01G0267500 Rorug01G0267600 Rorug03G0293600
rosa_samantha	Rh2BG557900 Rh4AG086500 Rh4CG083600 Rh4CG094300 Rh4DG195600 Rh5BG296200 Rh5BG488700 Rh5DG337900 Rh5DG565200
rosa_wichuraiana	Rw5G048490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	40
AcsI	RAATTY	1 cut(s)	96
AgsI	TTSAA	3 cut(s)	11, 20, 64
Alw26I	GTCTC	1 cut(s)	57
ApoI	RAATTY	1 cut(s)	96
AseI	ATTAAT	1 cut(s)	81
BccI	CCATC	1 cut(s)	24
BcoDI	GTCTC	1 cut(s)	57
BfaI	CTAG	1 cut(s)	47
BsaI	GGTCTC	1 cut(s)	57
BseGI	GGATG	1 cut(s)	35
BsmAI	GTCTC	1 cut(s)	57
Bso31I	GGTCTC	1 cut(s)	57
BspACI	CCGC	1 cut(s)	40
BspTNI	GGTCTC	1 cut(s)	57
BstF5I	GGATG	1 cut(s)	35
BstMAI	GTCTC	1 cut(s)	57
BtsCI	GGATG	1 cut(s)	35
CviAII	CATG	2 cut(s)	24, 56
Eco31I	GGTCTC	1 cut(s)	57
FaeI	CATG	2 cut(s)	27, 59
FaiI	YATR	5 cut(s)	25, 36, 57, 89, 154
FatI	CATG	2 cut(s)	23, 55
FokI	GGATG	1 cut(s)	42
FspBI	CTAG	1 cut(s)	47
Hin1II	CATG	2 cut(s)	27, 59
HinfI	GANTC	2 cut(s)	7, 125
Hpy188I	TCNGA	2 cut(s)	118, 138
Hsp92II	CATG	2 cut(s)	27, 59
MaeI	CTAG	1 cut(s)	47
MboII	GAAGA	2 cut(s)	16, 76
MluCI	AATT	2 cut(s)	78, 96
MlyI	GAGTC	1 cut(s)	119
MseI	TTAA	2 cut(s)	77, 81
MslI	CAYNNNNRTG	1 cut(s)	28
NlaIII	CATG	2 cut(s)	27, 59
PacI	TTAATTAA	1 cut(s)	81
PfeI	GAWTC	1 cut(s)	7
PleI	GAGTC	1 cut(s)	119
PpsI	GAGTC	1 cut(s)	119
PshBI	ATTAAT	1 cut(s)	81
RseI	CAYNNNNRTG	1 cut(s)	28
SaqAI	TTAA	2 cut(s)	77, 81
SchI	GAGTC	1 cut(s)	119
SgeI	CNNG	7 cut(s)	32, 36, 59, 68, 73, 115, 143
SmiMI	CAYNNNNRTG	1 cut(s)	28
Sse9I	AATT	2 cut(s)	78, 96
SsiI	CCGC	1 cut(s)	40
SspMI	CTAG	1 cut(s)	47
TasI	AATT	2 cut(s)	78, 96
TfiI	GAWTC	1 cut(s)	7
Tru1I	TTAA	2 cut(s)	77, 81
Tru9I	TTAA	2 cut(s)	77, 81
TspDTI	ATGAA	1 cut(s)	17
VspI	ATTAAT	1 cut(s)	81
XapI	RAATTY	1 cut(s)	96
XspI	CTAG	1 cut(s)	47

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.