Rroxscaffold_5G00340900

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
9394223 .. 9396417
2195 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00340900.1

Sequence Viewer

Length: 378 bp
ATGGGGAAGGACGCAAAAAGGCCAAAACGCAAGTCCAGGATGAGAAGGAAACCATCTGCCACCAGTGAAGCTAATGTTAAAATGGACGAAGAAGAAACATATGATGAAGATCAGGAAACTAATAATAAAAAGATGGATTACCAATCTTGGGTTGTTGGGAATGATGTTTCAGTTGGTAATAGTGGCGAAGATGCGTCAAAATTAGGTGGATGGGATGATCTTGAAAGAATGGAATCTGAAAAGAGGCAATCTCGAAGAAAGTCTAGGGGGAAGGGTAAGTTGAGTCGGAGAGAAAGAATTAGTGATACACCTCTTCTGCTGAGGTTGTTGATTGCAGTTTTCCCTTTTTTGGGTTCATGGACAAAGATATTTTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

14.54

Weight (kDa)

9.77

Isoelectric Point (pI)

64.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010950)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 3 cut(s) 148, 349, 350
AgsI TTSAA 1 cut(s) 224
AjnI CCWGG 1 cut(s) 35
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
AoxI GGCC 1 cut(s) 20
ArsI GACNNNNNNTTYG 2 cut(s) 17, 49
BbvCI CCTCAGC 1 cut(s) 320
BccI CCATC 3 cut(s) 61, 127, 204
BciT130I CCWGG 1 cut(s) 37
BfaI CTAG 1 cut(s) 264
Bme1390I CCNGG 1 cut(s) 37
BmrFI CCNGG 1 cut(s) 37
BmsI GCATC 1 cut(s) 181
BplI GAGNNNNNCTC 2 cut(s) 235, 267
Bpu10I CCTNAGC 1 cut(s) 320
BsaBI GATNNNNATC 1 cut(s) 108
Bsc4I CCNNNNNNNGG 3 cut(s) 148, 349, 350
Bse1I ACTGG 1 cut(s) 63
Bse8I GATNNNNATC 1 cut(s) 108
BseBI CCWGG 1 cut(s) 37
BseGI GGATG 3 cut(s) 45, 215, 220
BseJI GATNNNNATC 1 cut(s) 108
BseLI CCNNNNNNNGG 3 cut(s) 148, 349, 350
BseMII CTCAG 1 cut(s) 311
BseNI ACTGG 1 cut(s) 63
BshFI GGCC 1 cut(s) 22
BslI CCNNNNNNNGG 3 cut(s) 148, 349, 350
BsnI GGCC 1 cut(s) 22
Bsp143I GATC 2 cut(s) 109, 217
BspANI GGCC 1 cut(s) 22
BspCNI CTCAG 1 cut(s) 312
BsrI ACTGG 1 cut(s) 63
BssMI GATC 2 cut(s) 109, 217
Bst2UI CCWGG 1 cut(s) 37
Bst6I CTCTTC 1 cut(s) 318
BstDEI CTNAG 1 cut(s) 320
BstF5I GGATG 3 cut(s) 45, 215, 220
BstKTI GATC 2 cut(s) 112, 220
BstMBI GATC 2 cut(s) 109, 217
BstNI CCWGG 1 cut(s) 37
BstSCI CCNGG 1 cut(s) 35
BsuRI GGCC 1 cut(s) 22
BtsCI GGATG 3 cut(s) 45, 215, 220
BtsIMutI CAGTG 1 cut(s) 70
CseI GACGC 2 cut(s) 20, 183
CviAII CATG 1 cut(s) 357
CviJI RGCY 2 cut(s) 22, 71
CviKI_1 RGCY 2 cut(s) 22, 71
DdeI CTNAG 1 cut(s) 320
DpnI GATC 2 cut(s) 111, 219
DpnII GATC 2 cut(s) 109, 217
Eam1104I CTCTTC 1 cut(s) 318
EarI CTCTTC 1 cut(s) 318
EcoRII CCWGG 1 cut(s) 35
FaeI CATG 1 cut(s) 360
FaiI YATR 3 cut(s) 100, 102, 358
FatI CATG 1 cut(s) 356
FauNDI CATATG 1 cut(s) 100
FokI GGATG 3 cut(s) 52, 222, 227
FspBI CTAG 1 cut(s) 264
HaeIII GGCC 1 cut(s) 22
HgaI GACGC 2 cut(s) 20, 183
Hin1II CATG 1 cut(s) 360
HinfI GANTC 2 cut(s) 233, 283
Hpy188I TCNGA 2 cut(s) 238, 288
Hpy188III TCNNGA 3 cut(s) 113, 221, 252
HpyAV CCTTC 2 cut(s) 39, 265
HpyCH4V TGCA 1 cut(s) 335
HpyF3I CTNAG 1 cut(s) 320
Hsp92II CATG 1 cut(s) 360
Kzo9I GATC 2 cut(s) 109, 217
LpnPI CCDG 4 cut(s) 22, 49, 76, 98
LweI GCATC 1 cut(s) 181
MaeI CTAG 1 cut(s) 264
MalI GATC 2 cut(s) 111, 219
MboI GATC 2 cut(s) 109, 217
MboII GAAGA 6 cut(s) 101, 104, 119, 200, 267, 305
MluCI AATT 2 cut(s) 200, 297
MlyI GAGTC 1 cut(s) 292
MmeI TCCRAC 1 cut(s) 266
MnlI CCTC 3 cut(s) 237, 315, 321
MseI TTAA 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 37
MvaI CCWGG 1 cut(s) 37
NdeI CATATG 1 cut(s) 100
NdeII GATC 2 cut(s) 109, 217
NlaIII CATG 1 cut(s) 360
PfeI GAWTC 1 cut(s) 233
PfoI TCCNGGA 1 cut(s) 35
PleI GAGTC 1 cut(s) 291
PpsI GAGTC 1 cut(s) 291
Psp6I CCWGG 1 cut(s) 35
PspGI CCWGG 1 cut(s) 35
SaqAI TTAA 1 cut(s) 78
Sau3AI GATC 2 cut(s) 109, 217
SchI GAGTC 1 cut(s) 292
ScrFI CCNGG 1 cut(s) 37
SetI ASST 4 cut(s) 73, 208, 313, 326
SfaNI GCATC 1 cut(s) 181
Sse9I AATT 2 cut(s) 200, 297
SspMI CTAG 1 cut(s) 264
StyD4I CCNGG 1 cut(s) 35
TaqI TCGA 1 cut(s) 253
TasI AATT 2 cut(s) 200, 297
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TscAI CASTG 1 cut(s) 70
TspDTI ATGAA 2 cut(s) 120, 345
TspRI CASTG 1 cut(s) 70
XspI CTAG 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.